| ognizant Communication Corporation |
ONCOLOGY RESEARCH
ABSTRACTS
VOLUME 11, NUMBERS 1-12, 1999
Oncology Research, Volume 11, pp. 1-8, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
In Situ Gene Therapy for Prostate Cancer
Timothy C. Thompson
Baylor College of Medicine, Scott Department of Urology, Houston, TX 77030
The natural history of prostate cancer presents a dilemma for those interested in developing effective treatment for the disease. When the disease is localized (and therefore potentially curable by localized therapies), it is often of uncertain biological potential and in many cases will not progress to clinical significance. However, both experimental and clinical studies indicate that prostate cancer can metastasize early and/or from relatively small foci of prostate cancer within the gland and is often systemic at the time of diagnosis. Unfortunately, there are no curative therapies for metastatic prostate cancer. In general, currently used therapies with the potential to be curative involve a single cytoablative modality (radical prostatectomy and irradiation therapy) and are directed exclusively at the malignant cells within the prostate gland. At present the widespread use of these treatments alone has not resulted in substantial reduction in mortality from the prostate cancer. Gene therapy used alone or as an adjuvant approach could, at least conceptually, provide a rational solution for the prostate cancer dilemma. With gene therapy, it may be possible to treat localized and systemic disease effectively and simultaneously. Indeed, in situ gene therapy protocols in which viral vectors are used to transduce specific genes that generate cytotoxic activity and/or systemic immunity to the cancer offer hope for significantly reducing the mortality from this disease. This commentary discusses early studies specifically aimed toward developing in situ-based gene therapies that can generate cytotoxic activities in localized prostate cancers and/or the generation of an immune response in the primary tumor that would affect systemic disease.
Key words: Prostate cancer; Gene therapy; Adenovirus
Address correspondence to Timothy C. Thompson, Baylor College of Medicine, Scott Department of Urology, 6560 Fannin, Suite 2100, Houston, TX 77030. Tel: (713) 799-8718; Fax: (713) 794-7983; E-mail: timothyt@www.urol.bcm.tmc.edu
Oncology Research, Volume 11, pp. 9-16, 1999
0965-0407/99 $10.00 + .00
Copyright ©1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Sterically Stabilized Anti-GM3, Anti-Lex Immunoliposomes: Targeting to B16BL6, HRT-18 Cancer Cells
Sang Min Nam,1 Hong Sung Kim,1 Woong Shick Ahn,2 and Yong Serk Park1
1 Department of Medical Technology, Yonsei University,
Wonju 220-710, Republic of Korea
2Department of Obstetrics and Gynecology, College
of Medicine, Catholic University, Seoul 137-701, Republic of Korea
Various tumor-associated antigens have been identified as carbohydrates bound to lipids or to proteins expressed on tumor cell membranes. We prepared tumor-specific immunoliposomes by coupling anticarbohydrate antibodies, such as anti-ganglioside GM3 antibody (DH2) or anti-Lex antibody (SH1), to polyethylene glycol (PEG)-coated liposomes. In vitro and in vivo targetability of anti-GM3 and anti-Lex immunoliposomes to B16BL6 mouse melanoma cells and HRT-18 human colorectal adenocarcinoma cells were monitored with a fluorescence microscopy, and analyzed by biodistribution assay of the immunoliposome in mice bearing the tumor tissues. The antibody coupling to the PEG liposomes did not greatly diminish the circulation time of the liposome in the C57BL/6 mouse model. In vitro cytotoxicity of doxorubicin encapsulated in liposomes was enhanced by antibody coupling, but still behind free doxorubicin. However, in vivo antitumor therapeutic efficacy of doxorubicin encapsulated in the immunoliposomes was far greater than the free drug or in conventional liposomes. Doxorubicin encapsulated in anti-GM3immunoliposomes was able to reduce in vivo tumor growth and metastasis of B16BL6 mouse melanoma cells more greatly than any other formulations of the drug. This study suggests that tumor-associated antigens can be good target molecules for tumor-specific delivery of liposomal drugs or other synthetic drug delivery systems.
Key words: Cancer; Tumor-associated antigen; Immunoliposome; Doxorubicin; Target sensitivity
Address correspondence to Dr. Yong Serk Park, Department of Medical Technology, Yonsei University, Wonju 220-710, Republic of Korea. Tel: +82-371-760-2448; Fax: +82-371-763-5224; E-mail: yspark@dragon.yonsei.ac.kr
Oncology Research, Volume 11, pp. 17-31, 1999
0965-0407/99 $10.00 + .00
Copyright ©1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Osteoblasts Modulate Secretion of Urokinase-Type Plasminogen Activator (uPA) and Matrix Metalloproteinase-9 (MMP-9) in Human Prostate Cancer Cells Promoting Migration and Matrigel Invasion
Claudio Festuccia,1 Daniela Giunciuglio,2 Fulvio Guerra,1 Ida Villanova,1 Adriano Angelucci,1 Paola Manduca,3 Anna Teti,1 Adriana Albini,2 and Mauro Bologna1
1 Department of Experimental Medicine, Medical School,
University of L'Aquila, 67100, L'Aquila, Italy
2Advanced Biotechnologic Center, Istituto Nazionale
dei Tumori (IST), 16132 Genova, Italy
3Laboratory of Genetics, Department of Clinical and
Experimental Oncology, University of Genova, 16132 Genova, Italy
Prostate carcinoma (PRCA) cells metastasize to the skeleton with high frequency. Bone stores growth regulatory factors, which are released in active form during bone remodeling. We propose that bone cell-derived growth factors may induce the development of PRCA bone metastasis by recruiting tumor cells and increasing their proliferation in the bone microenvironment. Serum-free conditioned medium harvested from osteoblast cultures (OB CM) stimulated the in vitro chemotaxis of PRCA cells and invasion of a reconstituted basement membrane (Matrigel), suggesting enhanced invasive activity. Preosteoblastic cell CMs were less effective than CMs obtained from mature OB. CMs harvested from differentiated osteoblast cultures capable of matrix mineralization were more active compared to CMs from proliferating osteoblasts. OB CMs stimulated secretion of urokinase (uPA) and matrix metalloproteinase-9 (MMP-9). Inhibition of these matrix-degrading proteases by neutralizing antibodies and/or by inhibitors of their catalytic activity reduced Matrigel invasion. Secretion of uPA and activation of MMP-9 were most prominent by differentiated OB CMs with respect to poorly differentiated cells in vitro. These results are in agreement with several in vivo studies and indicate that factors produced during osteogenesis by bone cells stimulate PRCA cell chemotaxis and matrix proteases expression, thus representing potential targets for alternative therapies deterring the progression of PRCA metastasis to bone.
Key words: Bone metastasis; Prostate cancer; Urokinase; Metalloproteinase-9
Address correspondence to Claudio Festuccia, Dipartimento di Medicina Sperimentale, Cattedra di Patologia Generale, Università dell'Aquila, Coppito 2, 67100 L'Aquila, Italy. Tel: +39-0862-433527; Fax: +39-0862-433523; E-mail: festucci@univaq.it
Oncology Research, Volume 11, pp. 33-39, 1999
0965-0407/99 $10.00 + .00
Copyright ©1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Verotoxin Induces Apoptosis and the Complete, Rapid, Long-Term Elimination of Human Astrocytoma Xenografts in Nude Mice
Sara Arab,1 James Rutka,2, 5 and Clifford Lingwood1,3,4
1Section of Infection, Immunity, Injury & Repair and
Brain Tumor Research Laboratory, 2Division of Neurosurgery,
Research Institute, Hospital for Sick Children, Toronto, Ontario, Canada
Departments of 3Laboratory Medicine & Pathobiology,
4Biochemistry,
and 5Department of Neurosurgery, University of Toronto, Toronto,
Ontario, Canada
Verotoxin 1 (VT1) is an E. coli elaborated subunit toxin active only against (tumor) cell lines that express the VT1 receptor, globotriaosyl ceramide-Gb3. Astrocytomas can be highly malignant brain tumors that remain refractory to clinical treatment. Some human astrocytoma cell lines are particularly sensitive to VT1 in vitro. To address whether this represents a feasible approach to the elimination of these tumors in man, human astrocytoma tumor xenografts in nude mice were treated with verotoxin. Following a single low dose intratumoral injection of VT1, complete regression of a 1-cm-diameter tumor within 10 days was observed in all treated animals, without reoccurrence (up to 60 days). Apoptosis was demonstrated in both tumor and vascular cells within the treated xenograft. Verotoxin binding to tumor cells and blood vessels in sections of primary glioblastoma multiforme was found.
Key words: Antineoplastic; Angiogenesis; Globotriaosyl ceramide; Glioblastoma multiforme
Address correspondence to Clifford Lingwood, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada. Tel: (416) 813-5998; Fax: (416) 813-5993; E-mail: cling @sickkids.on.ca
Oncology Research, Volume 11, pp. 41-53, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Characterization of Selective Induction and Alteration of Xenobiotic Biotransforming Enzymes by Vanadium During Diethylnitrosamine-Induced Chemical Rat Liver Carcinogenesis
Anupam Bishayee, Shyamal Roy, and Malay Chatterjee
Division of Biochemistry, Department of Pharmaceutical Technology, Jadavpur University, Calcutta 700 032, India
Our recent studies have shown that vanadium, a dietary micronutrient, has a inhibitory response against experimentally induced rat liver carcinogenesis. In the present study, the effect of vanadium on hepatic xenobiotic biotransformation in rats exposed to diethylnitrosamine (DENA, 200 mg/kg, IP) was investigated to elucidate a possible mechanism of vanadium-mediated prevention of chemical carcinogenesis. Supplementary vanadium in drinking water at 0.5 parts per million (ppm) was employed ad lib before and after the intiation with DENA, before the initiation only, or during the promotional event. After 20 weeks, there was a significant reduction of hepatocyte nodules (HNs) (P < 0.01), nodule multiplicity (P < 0.001), and the number of nodules more than 3 mm in size in the long-term vanadium-supplemented rats than their DENA control counterparts. Total cytochrome P450 and b5 contents as well as cytochrome P450 2E1 (CYP2E1, EC 1.5.99), aryl hydrocarbon hydroxylase (AHH, EC 1.14.14.2), and UDP-glucuronyl transferase (UDPGT, EC 2.4.1.17) activities in the microsomal fractions of HNs and nonnodular surrounding parenchyma (NNSP) were found to be significantly decreased in DENA control group compared to untreated normal control. Though supplementary vanadium had little or no influence on the contents of cytochrome P450 and b5 and activities of CYP2E1 and AHH in HNs and NNSP, it substantially elevated the UDPGT activity in both HNs and NNSP liver areas. DENA treatment alone also brought about a sharp decrease in cytosolic UDP-glucose dehydrogenase (EC 1.1.1.22), DT-diaphorase (EC 1.6.99.2), and glutathione S-transferase (EC 2.5.1.18) activities in HNs and NNSP compared to normal liver. Supplementary vanadium was found to exert a marked induction in these cytosolic enzymes in HNs as well as NNSP when compared to DENA control. A positive correlation of phase I and phase II drug metabolizing enzymes in HNs or NNSP was always observed in DENA or DENA plus long-term vanadium-treated group. It is concluded that the chemoprotective effect of vanadium may be attributed to the substantial elevation of phase II conjugating enzymes, which may lead to a move and shift of the metabolic profile that may reduce the intracellular concentration of carcinogen-derived reactive intermediates.
Key words: Vanadium; Diethylnitrosamine; Hepatocarcinogenesis; Xenobiotic biotransforming enzymes; Rats
Address correspondence to Anupam Bishayee, Ph.D., Division of Radiation Research, MSB F-451, Department of Radiology, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, 185 South Orange Avenue, Newark, NJ 07103-2714. Tel: (973) 972-6961; Fax: (973) 972-6474; E-mail: bishayan@umdnj.edu
Oncology Research, Volume 11, pp. 55-61, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Melanoma-Inhibitory Activity Protein Concentrations in the Blood of Melanoma Patients Treated With Immunotherapy
D. Dréau,1 A. K. Bosserhoff,2 R. L. White,1 R. Buettner,2 and W. D. Holder1
1Department of General Surgery Research, Carolinas Medical
Center, Charlotte, NC 28203
2Department of Pathology and Dermatology, University
of Regensburg Medical School, D93042, Regensburg, Germany
Melanoma inhibitory activity protein (MIA) has been detected in patients with advanced melanoma. The present study measured the variations in blood concentrations of MIA in 84 patients with AJCC stage II to IV melanoma by ELISA. Patients treated with repeated injections of a polyvalent melanoma vaccine (PMV), interferon-a-2b (IFN-a2b) or interleukin-2 (IL-2) were followed during treatment duration. Before treatment, patients treated with PMV or IFN-\GK\a2b had comparable low MIA concentrations, whereas most IL-2-treated patients had higher MIA levels. At the end of treatment, MIA concentrations were higher in patients with progressive disease (PD) than in patients with no clinical evidence of melanoma (NPD) for PMV, IFN-a2b, or IL-2 therapy (3.7 ± 0.2 vs. 11.5 ± 5.4 ng/ml, 3.8 ± 0.2 vs. 8.3 ± 1.7 ng/ml, and 2.3 ± 0.7 vs. 20.2 ± 7.4 ng/ml, respectively, P < 0.05). In constrast to stable MIA concentrations measured in NPD patients, significant increase in MIA levels were observed in PD patients over time regardless of treatment (P < 0.05). In 20 of the 27 patients who had melanoma recurrence or progression, MIA concentrations were above 4.5 ng/ml. Finally, in these 20 patients, MIA concentrations above 4.5 ng/ml were observed prior to clinical evidence of progression (P < 0.01).
Key words: Blood; ELISA; IFN-a2b; IL-2; Immunotherapy; Marker; Melanoma; Melanoma-inhibitory activity protein (MIA); Threshold; Vaccine
Address correspondence to Didier Dréau, Ph.D., Department of General Surgery Research, Carolinas Medical Center, PO Box 32861, 1000 Blythe Blvd., Charlotte, NC 28203. Tel: (704) 355-8254; Fax: (704) 355-7203; E-mail: ddreau@carolinas.org
Oncology Research, Vol. 11, pp. 63-69, 1999
0965-0407/99 $10.00 + 00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
BRCA1 and BRCA2 Gene Mutation Analysis: Visit to the Breast Cancer Information Core (BIC)
Dejun Shen, Jaydutt V. Vadgama, and Breast Cancer Information Core
Department of Medicine, Charles R. Drew University of Medicine and Science, UCLA School of Medicine, Los Angeles, CA 90059
Breast cancer is a leading cancer in American women. About 7% of breast cancer is due to inheritance of mutated genes BRCA1 and BRCA2. Numerous investigations have revealed a number of mutations in BRCA1 and BRCA2 genes. The inheritance of the mutated BRCA1 or BRCA2 genes accounts for 45% and 35%, respectively, of hereditary breast cancers. A central database named Breast Cancer Information Core (BIC) has been established in the National Human Genome Research Institute (NHGRI) to coordinate the information related with BRCA1 and BRCA2 research. Nearly half of the mutations (49%) in the BRCA1 gene are frameshift mutations and the cancer-causing mutations account for 66% of all entries. However, for the BRCA2 gene frameshift mutations and cancer-causing mutations account for only 35% and 43%, respectively, of all entries. The significance of a large portion of missense sequence variants (24% of BRCA1 mutations and 47% of BRCA2 mutations) needs further evaluation. The incidence of 185delAG and 5382insC in BRCA1 gene and 6174delT in BRCA2 gene is predominantly high and the founder effect of these mutations is discussed.
Key words: BRCA1; BRCA2; Mutation; Breast Cancer Information Core (BIC)
Address correspondence to Dr. Jaydutt Vadgama, Charles R. Drew University of Medicine and Science, Division of Laboratory Research and Development, Molecular Oncology Program, 1621 E. 120th Street, Los Angeles, CA 90059. Tel: (323) 563-4853; Fax: (323) 563-4859; E-mail: vadgamaj@modernweb.net
Oncology Research, Vol. 11, pp. 71-75, 1999
0965-0407/99 $10.00 + 00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Differences in Apoptosis Induced by Anticancer Drugs in Sublines (SKG-3a, SKG-3b) From a Human Uterine Cervical Epidermoid Carcinoma
Motoo Takahashi,1 Shiro Kataoka,1 Eiichi Kobayashi,1 Yasuhiro Udagawa,2 Daisuke Aoki,2 Shinji Oie,2 Akiko Kozu,2 and Shiro Nozawa2
1Pharmaceutical Research Laboratory, Kirin Brewery
Co., Ltd., 3 Miyahara-cho, Takasaki, Gunma, Japan
2Department of Obstetrics and Gynecology, School of Medicine,
Keio University, 35 Shinanomachi, Shinjuku, Tokyo, Japan
SKG-3a and SKG-3b are two distinct human uterine cervical epidermoid carcinoma cell lines derived from a single donor. We studied these two closely related cell lines from the standpoint of drug susceptibility. The growth inhibitory effects of cisplatin (CDDP), doxorubicin (ADM), etoposide (VP-16), and paclitaxel (taxol) on SKG-3a and SKG-3b cells assessed by crystalviolet dye uptake assay were almost the same. SKG-3b cells treated with CDDP, ADM, VP-16, and taxol showed the apoptotic cell death, whereas apoptosis in SKG-3a cells was not induced by these anticancer drugs. Caspase-3 activity was increased only in the SKG-3b cell lysate after treatment with CDDP, ADM, and VP-16 but was not found in the SKG-3a cell lysate. These results indicate that despite growth inhibitory effects of anticancer drugs being almost the same, there may be differences in the common signaling pathways involved in the apoptotic process between SKG-3a and SKG-3b obtained from the same tumor.
Key words: Apoptosis; Caspase-3; SKG-3a; SKG-3b; Anticancer drugs
Address correspondence to Motoo Takahashi, Pharmaceutical Research Laboratory, Kirin Brewery Co., Ltd., 3 Miyahara-cho, Takasaki, Gunma, Japan. Tel: +81-27-346-9779; Fax: +81-27-346-1672; E-mail: mtakahashi@kirin.co.jp
Oncology Research, Vol. 11, pp. 77-84, 1999
0965-0407/99 $10.00 + 00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Mechanism of Antimitogenic Action of Vitamin D in Human Colon Carcinoma Cells: Relevance for Suppression of Epidermal Growth Factor-Stimulated Cell Growth
Wei-Min Tong,1 Harald Hofer,1 Adolf Ellinger,2 Meinrad Peterlik,1 and Heide S. Cross1
1Department of General and Experimental Pathology and 2Institute of Histology and Embryology II, University of Vienna Medical School, A-1090 Vienna, Austria
Because the efficacy of 1a,25-dihydroxyvitamin D3 [1a,25-(OH)2D32] in treatment of colon cancer might critically depend on its ability to specifically counteract epidermal growth factor (EGF)-stimulated tumor cell growth, we utilized human colon adenocarcinoma-derived cells in primary culture as well as the Caco-2 cell line to elucidate possible sites of interaction of 1a,25-(OH)2D3 with signaling from EGF receptor activation. In both types of colon cancer cells investigated, 10-8 M 1a,25-(OH)2D3 reduced basal cell proliferation by about 50%, and prevented any rise in proliferation when colon cancer cells were treated with 25 ng/ml EGF: this can be explained by a marked inhibitory effect of 1a,25-(OH)2D3 on EGFR mRNA and protein expression. The steroid hormone also seemingly promotes EGF-induced internalization of apical and basolateral membrane EGFR. In addition, 1a,25-(OH)2D3 significantly reduced basal and EGF-stimulated expression of cyclin D1 at the mRNA and protein level in primary cultures as well as in the Caco-2 cell line. The ability of 1a,25-(OH)2D3 to interfere with a key event in cell cycle control and thereby to block mitogenic signaling from EGF could be seen as advantageous for the potential use of vitamin D compounds in colon cancer therapy.
Key words: Colorectal cancer; Primary cultures; Caco-2 cells; 1a,25-Dihydroxyvitamin D3; Epidermal growth factor receptor; Cyclin D1
Address correspondence to Dr. Meinrad Peterlik, Department of General and Experimental Pathology, Waehringer Guertel 18-20, A-1090 Vienna, Austria. Tel: 43 1 40400 5120; Fax: 43 1 40400 5130.
Oncology Research, Vol. 11, pp. 85-90, 1999
0965-0407/99 $10.00 + 00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Downregulation of TNF Receptor-Associated Protein-2/p97 in Renal Cell Carcinoma
Marike J. J. G. Stassar,1 Claudia Pitzer,1 and Margot Zöller1,2
1Department of Tumor Progression and Immune Defense,
German Cancer Research Center, Heidelberg, Germany
2Department of Applied Genetics, University of Karlsruhe,
Karlsruhe, Germany
Messenger RNA differential display was used to identify genes that are differentially expressed in normal kidney and kidney tumors. We isolated a clone that was uniquely expressed in the normal kidney cell line KCTL-22. The differential expression was confirmed by Northern blot analysis. The cloned cDNA showed 100% homology with type-1 TNF receptor-associated protein-2 (TRAP-2), which is identical to the 97-kDa subunit 2 of the 26S protease (p97). TRAP-2/p97 mRNA was absent or downregulated in two out of four renal cell carcinoma (RCC) lines and in one out of five tissue samples of freshly harvested RCC. All normal tissues tested showed TRAP-2/p97 expression, with highest expression being observed in heart and skeletal muscle. The TRAP-2/p97 mRNA was also detectable in tumor cell lines of nonrenal origin. However, expression levels varied considerably, low levels in particular being observed frequently in malignant melanoma. Although in the tested samples expression of additional subunits of the proteasome, like LMP-2, LMP-7, and LMP-10, were unaltered, the downregulation of TRAP-2/p97 in tumor tissue might affect the processing and presentation of tumor-associated antigens.
Key words: Differential display; Differential expression; Low molecular weight proteins; Renal cell carcinoma; TRAP-2; Tumor-associated antigens
Address correspondence to Prof. Dr. Margot Zöller, German Cancer Research Center, Department of Tumor Progression and Immune Defense, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany. Tel: ++49-6221-422454; Fax: ++49-6221-424760; E-mail: m.zoeller@dkfz-heidelberg.de
Oncology Research, Vol. 11, pp. 91-99, 1999
0965-0407/99 $10.00 + 00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Dimerization of Mitochondrial Bax Is Associated With Increased Drug Response in Bax-Transfected A253 Cells
Bin Guo, Ming-biao Yin, Károly Tóth, Shousong Cao, Rami G. Azrak, and Youcef M. Rustum
Grace Cancer Drug Center, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263
Human head and neck squamous cell carcinoma A253 cells, which do not express p53 and p21 proteins, were engineered to stably express about 50-fold higher level of Bax protein (A253/Bax) than the mock-transfected (A253/vec) or parental cells. Using these cell lines, studies were carried out to evaluate the role of Bax in response to anticancer drugs and to study the associated mechanisms. A253/Bax cells exhibited a significant increase in in vitro sensitivity to various anticancer drugs, including tomudex (9.5-fold), SN-38 (13.8-fold), doxorubicin (7.9-fold), taxol (3.1-fold), 5-FU (2.7-fold), and 5-FU/LV (4.5-fold). Increased level of drug-induced apoptosis was observed in A253/Bax cells in a drug concentration-dependent manner. In untreated A253/Bax cells, Bax was expressed in a monomeric state. Treatment with tomudex induced the formation of Bax dimer in a drug concentration-dependent manner. Dimerization of Bax occurred only in mitochondria, while the cytosolic Bax was retained in the monomeric state. Low level of Bax dimerization was also detected in parental A253 cells following tomudex exposure. In addition, Bax dimer formation was associated with mitochondrial cytochrome c release and activation of caspases in A253/Bax cells. The data suggest that Bax overexpression increases drug response by enhancing drug-induced apoptosis. Furthermore, dimerization of mitochondrial Bax and downstream mechanisms are associated with drug-induced apoptotic cell death and increased drug sensitivity.
Key words: Apoptosis; Bax dimerization; Cytochrome c; Caspase; Drug response
Address correspondence to Dr. Youcef M. Rustum, Grace Cancer Drug Center, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263. Tel: (716) 845-4532; Fax: (716) 845-8857; E-mail: rustum@sc3103.med.buffalo.edu
Oncology Research, Vol. 11, pp. 101-104, 1999
0965-0407/99 $10.00 + 00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Infrequent Genetic Alterations of p53, p16 Genes and Polymorphism in fhit Gene in Indian Myelodysplastic Syndrome
Karuppiah Kannan,1 Reeja Tharu,2 P. M. Gopinath,2 T. P. R. Bharadwaj,3 Arasampattu K. Munirajan,4 Nobuo Tsuchida,4 and Govindaswamy Shanmugam1
1Cancer Biology Division, School of Biological Sciences,
Madurai Kamaraj University, Madurai-625 021, India
2Department of Genetics, Dr. A. L. M. Post Graduate Institute
of Basic Medical Sciences, University of Madras, Chennai-600 113, India
3Madras Medical College, Chennai, India
4Department of Molecular Cellular Oncology and Microbiology,
Tokyo Medical and Dental University, Tokyo, Japan
Alterations in the tumor suppressor genes p53, p16, and fhit were studied in myelodysplastic syndrome (MDS) samples of Indian patients. PCR-SSCP analysis showed evidence for the presence of polymorphism in fhit gene in 7 of 15 samples. We failed to get any evidence for mutation in the p53, p16, and fhit genes. These results indicate that mutational inactivation of these genes may not play a major role in the development of myelodysplastic syndrome.
Key words: Tumor suppressor genes; Gene alterations; MDS; p53; p16; fhit
Address correspondence to Dr. K. Kannan at his present address: Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot 76100, Israel. Tel: +972-8-9342987; Fax: +972-8-9344125; E-mail: lckannan@dapsas1.weizmann.ac.il
Oncology Research, Volume 11, pp. 109-113, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
The Development of Awareness of the Carcinogenic Hazard of Inhaled Iron
Eugene D. Weinberg
Department of Biology and Program in Medical Sciences, Indiana University, Bloomington, IN 47405
Numerous studies have observed that workers in ferriferous industries have an elevated risk of respiratory tract neoplasia. Research at the cellular and animal model levels indicates that iron compounds, per se, are carcinogenic. However, some investigators have suggested that inhaled iron compounds are merely carriers of other carcinogens. Evidence is presented that iron apparently is a principal carcinogenic hazard in inhalation of silicon dioxide, asbestos, and tobacco smoke. Included in the discussion are unresolved questions concerning the precise role of inhaled iron as a carcinogen.
Key words: Asbestos; Inhaled iron withholding; Lung cancer; Tobacco smoking
Address correspondence to Eugene D. Weinberg, Jordan Hall 142, Indiana University, Bloomington, IN 47405. Tel: (812) 855-4842; Fax: (812) 855-6705; E-mail: eweinber@indiana.edu
Oncology Research, Volume 11, pp. 115-124, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Short-Term Cultures of Clinical Tumor Material: Potential Contributions to Oncology Research
Bruce C. Baguley, Elaine S. Marshall, and Graeme J. Finlay
Auckland Cancer Society Research Centre, University of Auckland School of Medicine, Auckland, New Zealand
The culture of surgical tumor specimens has long been considered as a potential approach to the tailoring of chemotherapy and radiotherapy to the individual patient, and to the development of improved therapy. Recent work highlighting the importance of cell-cell interactions in the growth and survival of cancer tissue, as well the demonstrated importance of drug- or radiation-induced loss of tumor cells (for instance by apoptosis), points to a need to reexamine the question of what information might be derived from such cultures. In this commentary, we consider whether the short-term culture of human tumor tissue as small cellular aggregates, preserving to some extent the three-dimensional organization of tumors in vivo, can be used to obtain information on the behavior of cancer cells before and after therapy. Using [3H]thymidine incorporation as an end-point, we show how the shapes of dose-response curves might be used to estimate two key cytokinetic properties of the cultured cells, proliferation rate, and susceptibility to drug- or radiation-induced cell death. We have illustrated this discussion with our studies of melanoma, ovarian cancer, and lung cancer samples. We consider how application of culture methods may lead not only to the discovery of new antitumor drugs, but also to improved choice of patients' treatment.
Key words: Clinical; Primary culture; Sensitivity testing; Cytokinetics; Apoptosis; Doubling time; Paclitaxel; Carboplatin
Address correspondence to Bruce C. Baguley, Auckland Cancer Society Research Centre, University of Auckland School of Medicine, Private Bag 92019, Auckland, New Zealand. Tel: (64-9) 3737 999, ext. 6142; Fax: (64-9) 3737 502. E-mail: b.baguley@auckland.ac.nz
Oncology Research, Volume 11, pp. 125-132, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Induction of Apoptosis in T98G Glioblastoma Cells by Transfection of GML, a p53 Target Gene
Kazuki Ueda,1,2 Yasuo Miyoshi,1 Takashi Tokino,3 Masahiro Watatani,2 and Yusuke Nakamura1,4
1Division of Clinical Genetics, B9, Osaka University Medical
School, Osaka 565-0871, Japan
2First Department of Surgery, Kinki University School of
Medicine, Osaka 589-0014, Japan
3Department of Molecular Biology, Cancer Research Institute,
Sapporo Medical University, Sapporo, Hokkaido 060-0061, Japan
4Laboratory of Molecular Medicine, Institute of Medical
Science, University of Tokyo, Tokyo 108-0071, Japan
Expression of the glycosyl-phosphatidylinositol-anchored molecule-like protein (GML) gene, a p53 target, correlates with the sensitivity of some cancer cell lines to anticancer drugs and ionizing radiation. To investigate the function of GML further, we introduced the GML cDNA into various cancer cell lines under control of the tetracycline-regulated system. When we introduced GML into human glioblastoma cell line T98G, which lacks wild-type p53 and expresses no endogenous GML, we observed significant growth suppression accompanied by G2/M arrest in two independent, stable cell lines. We confirmed induction of apoptosis by fluorescence-activated cell sorting (FACS) analysis and nuclear staining. Our results indicated that GML could induce apoptosis of T98G without functional p53, and implied that GML plays a crucial role in the apoptotic pathway in some cancer cells.
Key words: GML; p53 target; T98G; Apoptosis
Address correspondence to Dr. Yusuke Nakamura, Laboratory of Molecular Medicine, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo, 108-0071, Japan. Tel: 81-3-5449-5372; Fax: 81-3-5449-5433; E-mail: yusuke@ims.u-tokyo.ac.jp
Oncology Research, Volume 11, pp. 133-144, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Antitumor Effect of Vaccinia Virus in Glioma Model
Tatyana M. Timiryasova,1 Jun Li,2 Bing Chen,1 Daneil Chong,1 William H. R. Langridge,1,3 Daila S. Gridley,2,4 and Istvan Fodor1,3\
1Center for Molecular Biology and Gene Therapy, 2Departments of Microbiology & Molecular Genetics, 3Biochemistry, and 4Radiation Medicine, Loma Linda University School of Medicine, Loma Linda, CA 92354
The ability of certain viruses to lyse cancer cells suggests that they may have potential as oncolytic agents. We investigated the effect of vaccinia virus (VV) and its recombinant derivatives (recVV2, rVV-p53) on growth of C6 rat glioma cells that form fast growing tumors in athymic nude mice. VV effectively infected C6 cells in vitro, inducing high level of foreign gene expression. Most of C6 cells infected in vitro with rVV-p53 expressing the tumor suppressor p53 protein showed apoptosis-specific morphological changes in DAPI-stained nuclei and DNA fragmentation pattern on gel electrophoresis; infection with VV induced low level of cell apoptosis. In an ex vivo experiment, VV-infected C6 cells were implanted SC in athymic nude mice and tumor development was monitored. In contrast to the control PBS group, most of mice implanted with infected cells remained tumor free until the end of the observation period. In an in vivo experiment, injection of VV or rVV-p53 after the C6 cells had been implanted in nude mice induced effective inhibition of tumor growth in comparison with control PBS groups. The oncolytic effect was greater with rVV-p53, apparently due to overexpressed p53 and p53-mediated cell apoptosis. In study of virus virulence we did not observe disease symptoms in athymic mice infected with a high dose of VV. Experimental results indicate that vaccinia virus itself and vaccinia-mediated delivery of therapeutic genes represent novel potential strategies for tumor therapy.
Key words: Vaccinia virus; p53; Glioma; Gene expression; Tumor
Address correspondence to Istvan Fodor, Ph.D., Center for Molecular
Biology and Gene Therapy, Loma Linda University School of Medicine, 11085
Campus Street, Mortensen Hall, Loma Linda, CA 92354. Tel: (909) 824-4300,
ext. 81398; Fax: (909) 478-4177; E-mail: ifodor@som.llu.edu
Oncology Research, Volume 11, pp. 145-152, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Biological Evaluation on Different Human Cancer Cell Lines of Novel Colchicine Analogs
Rosa De Vincenzo,1 Cristiano Ferlini,1 Mariagrazia Distefano,1 Cristiana Gaggini,1 Antonella Riva,3 Ezio Bombardelli,3 Paolo Morazzoni,3 Bruno Danieli,4 Giovanni Capelli,2 Salvatore Mancuso,1 and Giovanni Scambia1
Departments of 1Obstetrics and Gynecology and 2Hygiene,
Catholic University, Rome
3Indena, Spa, Milan
4Department of Chemistry, University of Milan, Milan, Italy
Three new 7-0-substituted deacetamidothiocolchicine derivatives have been evaluated for their antitumor activity against various human tumor cell lines, some of which express the multidrug resistance (MDR) phenotype, for their impact on the cell cycle and their binding to tubulin. Colchicine and thiocolchicine were used as reference compounds. Thiocolchicine was the most active agent on MDR-negative cells in terms of growth inhibition, whereas for multidrug-resistant cells, thiocolchicone was the most active compound (IC50 = 14 nM). As indicated by statistical analysis, a perfect agreement for the potency order (IC50 values) of the compounds between all the MDR-negative cancer cells (k = 1.00), a poor agreement between MDR-positive and MDR-negative cancer lines, and a moderate agreement (k = 0.50) between the two resistant cancer cells MCF-7 ADRr and CEM VBL were observed. To gain further insight into the mechanism of the antitumor activity of colchicinoids, the most active compounds, colchicone and thiocolchicone, were selected to evaluate their effect on cell cycle, apoptosis, and tubulin interaction. The highest recruitment activity into the G2/M phase of the cell cycle was detected in thiocolchicone-treated breast cancer cells. Interestingly, after 72 h of culture, when the cell cycle block subsided, a consistent amount of DNA fragmentation, a hallmark of apoptosis, was evident. Morphological analysis of MCF-7 ADRr cells confirmed this hypothesis and revealed that thiocolchicone was able to induce apoptosis in this MDR-bearing model. We also demonstrated, using flow cytometry, that thiocolchicone interacts with a and b-tubulin, thereby affecting the expression of both subunits.
Key words: Colchicine analogs; Thiocolchicone; Human cancer cells; Multidrug resistance (MDR); Apoptosis,a- and b-tubulin
Address correspondence to Prof. Giovanni Scambia, Department of Gynecology & Obstetrics, Catholic University of the Sacred Heart, L.go Gemelli, 8-00168 Rome, Italy. Tel: 06/35508736; Fax: 06/35508736, 06/3051160; E-mail: gemelli@cdq.it
Oncology Research, Volume 11, pp. 153-159, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
In Vivo Studies of Adenovirus-Mediated p53 Gene Therapy for cis-Platinum-Resistant Human Ovarian Tumor Xenografts
Kaimei Song, Kenneth H. Cowan, and Birandra K. Sinha
Medicine Branch, Division of Clinical Sciences, National Cancer Institute, NIH, Bethesda, MD
We have recently reported that mutations of the tumor suppressor p53 gene are associated with the development of resistance to cis-platinum in human ovarian cancer cells, and that adenovirus-mediated reintroduction of the wild-type p53 (wtp53) gene in ovarian tumor cells resulted in the sensitization of tumor cells to cis-diamminedichloroplatinum (II) (CDDP). The purpose of this study was to evaluate whether IP treatment of CDDP-resistant tumor cells expressing mutant p53 (mutp53) with a recombinant adenovirus expressing wtp53 (Adwtp53) would result in the sensitization of resistant cells to CDDP. In order to determine whether IP injection of a recombinant adenovirus would result in expression of the transgene in tumor cells growing intraperitoneally, we first injected A2780/CP cells in nude mice and 10 days later the mice were injected IP with a recombinant adenovirus expressing b-galactosidase (Adb-gal). Twenty-four hours following IP injection of Adb-gal, tumors were removed and stained for b-gal. While tumors showed extensive staining for b-gal, indicating internalization of adenovirus and the expression of the transgene in tumors, no expression of b-gal protein was detected in liver. IP treatment of A2780/CP tumor xenografts with Adwtp53 caused extensive tumor cell death, which was further enhanced by CDDP. Treatment with Adwtp53 (5 ´ 107 pfu/day, 3-5 treatments) resulted in a significant decrease in tumor volume and increase in animal survival compared to either no treatment or treatment with vector alone without p53 gene. Additional therapy with CDDP (1 mg/kg/day ´ 3-4) further reduced tumor volume and increased survival (30-40%), suggesting that combination therapy of Adwtp53 and CDDP was better than single agents alone. Our results indicate that IP dosing with adenovirus-mediated wtp53 gene therapy could be beneficial in combination with CDDP for the treatment of ovarian tumors expressing mutp53.
Key words: cis-Platinum; Drug resistance; Adenovirus; p53 gene; Gene therapy; Combination gene therapy; Ovarian carcinoma
Address correspondence to Dr. Birandra K. Sinha, 10817 Game Preserve Rd., Gaithersburg, MD 20878. Tel: (301) 990-0464; Fax: (301) 990-0478; E-mail: bks-cs@starpower.net
Oncology Research, Volume 11, pp. 161-168, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
The Metastatic Process: Basic Research and Clinical Implications
Ann F. Chambers
London Regional Cancer Centre, and Department of Oncology, University of Western Ontario, London, Ontario N6A 4L6 Canada
Metastatic spread of cancer is responsible for most deaths due to cancer. An understanding of the process of metastasis at a level sufficient to permit the development of effective antimetastatic therapies thus has the potential to make an impact on mortality from cancer. Recent experimental studies using in vivo videomicroscopy, which have allowed direct observation and quantification of steps in metastasis as they occur in vivo, have led to new insights into the metastatic process and steps that result in metastatic inefficiency. It is important to learn if these findings are relevant to clinical cancer. If these experimental results reflect the situation that occurs during metastasis of human cancers, there are clinical implications that deserve evaluation. In this Commentary, these results are discussed in the context of human cancer, and the possible clinical implications of the experimental findings are considered. The findings are also discussed in the context of results that suggest that the timing of breast cancer surgery during the menstrual cycle in premenopausal women may affect probability of survival, and possible implications of the findings for tumor dormancy are discussed.
Key words: Metastatic inefficiency; Videomicroscopy; Animal models; Tumor dormancy; Timing of surgery relative to menstrual cycle
Address correspondence to Dr. Ann F. Chambers, London Regional Cancer Centre, 790 Commissioners Road East, London, Ontario N6A 4L6 Canada. Tel: (519) 685-8652; Fax: (519) 685-8646; E-mail: ann.chambers@lrcc.on.ca
Oncology Research, Volume 11, pp. 169-178, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Cellular Basis of Breast Cancer Susceptibility
J. Russo and I. H. Russo
Breast Cancer Research Laboratory, Fox Chase Cancer Center, Philadelphia, PA 19111
Breast cancer originates in undifferentiated terminal structures of the mammary gland. The terminal duct of the Lob 1 of the human female breast is the site of origin of ductal carcinomas. Cell replication and the concentration of estrogen receptors type a in Lob 1 are at their peak during early adulthood, at a time during which the breast is more susceptible to carcinogenesis, decreasing considerably with aging. More importantly, when treated with carcinogens in vitro they express phenotypes indicative of cell transformation. These studies indicate that in humans there is a target cell of carcinogenesis, which is found in a specific compartment whose characteristics are a determinant factor in the initiation event. These target cells will become the stem cells of the neoplastic event, depending upon: a) topographic location within the mammary gland tree, b) age at exposure to a known or putative genotoxic agent, and c) reproductive history of the host. Epidemiological findings such as the higher incidence of breast cancer in nulliparous women and in women having early menarche support this concept, because it parellels the higher cancer incidence elicited by carcinogens when exposure occurs at a young age. In addition, it has been shown that increase in parity is associated with a pronounced decrease in the risk of breast cancer, each additional live birth conferring a 10% risk reduction. Thus, the protection afforded by early full-term pregnancy in women could be explained by the higher degree of differentiation of the mammary gland at the time in which an etiologic agent or agents act. The relevance of our work lies in the side by side comparison of in vivo and in vitro studies in the human breast that validates experimental data for extrapolation to the human situation. The finding that cell proliferation is of importance for cancer initiation, whereas differentiation is a powerful inhibitor, provides novel tools for developing rational strategies for breast cancer prevention and control.
Key words: Breast; Cancer; Development; Lobules; Estrogen receptor; Cell proliferation; Ki67; Progesterone receptor; Cell transformation; MCF-10F; Human breast epithelial cell; Chemical carcinogenesis; Pathogenesis
Address correspondence to Jose Russo, M.D., Director, Breast Cancer Research Laboratory, Fox Chase Cancer Center, 7701 Burholme Avenue, Philadelphia, PA 19111. Tel: (215) 728-4782; Fax: (215) 728-2180; E-mail: J_Russo@fccc.edu
Oncology Research, Volume 11, pp. 179-185, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
The Effects of Vasodilating Drugs on pH in Tumors
EIsuke Adachi and Ian F. Tannock
Department of Medical Biophysics, Ontario Cancer Institute/Princess Margaret Hospital, Toronto, Ontario M5G 2M9 Canada
Hydralazine has been used widely to reduce tumor blood flow and thereby to induce hypoxia and to reduce extracellular pH (pHe) in tumors. Here we have investigated and compared the effects of the vasodilating drugs hydralazine, captopril, nifedipine, prazosin, sodium nitroprusside, and labetalol to reduce pHe in EMT-6 and KHT tumors of mice and to cause antitumor effects. After a single injection, captopril was most effective in reducing pHe in EMT-6 tumors with a decrease in mean pHe from 6.93 to 6.67 at 2 h after injection, while nifedipine was most effective for KHT tumors with a decrease in mean pHe from 6.96 to 6.75 at 1 h after injection. During 72 h of chronic administration into mice bearing tumors, nifedipine was ineffective in reducing pHe, but both captopril and hydralazine caused a small but significant reduction of pHe. Captopril caused significant delay in growth of the tumors, but had only a small effect on clonogenic cell survival. Captopril appears to be the most effective vasodilating drug to enhance tumor acidity.
Key words: Vasodilating drugs; pH; Tumor physiology
Address correspondence to Dr. Ian F. Tannock, Department of Medical Oncology & Hematology, Ontario Cancer Institute/Princess Margaret Hospital, 610 University Avenue, Suite 5-208, Toronto, Ontario M5G 2M9 Canada. Tel: (416) 946-2245; Fax: (416) 946-6546; E-mail: ian_tannock@pmh.toronto.on.ca
Oncology Research, Volume 11, pp. 187-194, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Inhibition of Interleukin-8 Reduces Human Malignant Pleural Mesothelioma Propagation in Nude Mouse Model
Gabriella Galffy, Kamal A. Mohammed, Najmunnisa Nasreen, Melissa J. Ward, and Veena B. Antony
Division of Pulmonary and Critical Care Medicine, Department of Medicine, Veterans Affairs Medical Center, Indiana University Medical Center, Indianapolis, IN 46202
Malignant pleural mesothelioma (MPM), despite current therapeutic strategies, is still an aggressive tumor with a very poor prognosis. Interleukin-8 (IL-8), a proinflammatory and angiogenic cytokine, has an important role in tumor-related neovascularization. IL-8 has also been described to function as an autocrine growth factor. The purpose of this study was to evaluate the effect of IL-8 antibody (IL-8 Ab) on progression of MPM in vivo. Athymic nude mice (n = 65) were injected intrapleurally with human MPM cells (CRL-2081), equally divided into three groups (IL-8 Ab, control Ab, untreated), and received IP injection of IL-8 Ab, control Ab, or no treatment, respectively, every 48 h up to 15 days. Pleural fluid and serum IL-8 levels, and tumor and body weight of mice were measured following 5, 10, and 15 days of tumor injection. We found that both pleural fluid and serum IL-8 levels were significantly (P < 0.0001) lower in mice that received IL-8 Ab when compared to the other groups. In this group, lower IL-8 levels were associated with a decreased rate of tumor growth. There was a significant and direct correlation between pleural fluid IL-8 levels and tumor weight of all animals enrolled in this study (P < 0.0001, r = 0.88). We demonstrate that antibody treatment against IL-8 decreased human MPM progression. Our results suggest that treatments targeting the decrease of MPM-associated IL-8 levels or the effects of this protein may inhibit mesothelioma growth.
Key words: Interleukin-8; Mesothelioma; Nude mouse model
Address correspondence to Veena B. Antony, M.D., Veterans' Affairs Medical Center, 1481 West 10th Street, 111-P, Indianapolis, IN 46202. Fax: (317) 554-0262; E-mail: vantony@iupui.edu
Oncology Research, Volume 11, pp. 195-203, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
9-(2-Phosphonylmethoxyethyl)-N6-Cyclopropyl-2,6-Diaminopurine: A Novel Prodrug of 9-(2-Phosphonylmethoxyethyl)Guanine With Improved Antitumor Efficacy and Selectivity in Choriocarcinoma-Bearing Rats
Lieve Naesens,1 Sigrid Hatse,1 Constant Segers,2 Erik Verbeken,3 Erik De Clercq,1 Mark Waer,2 and Jan Balzarini1
1Rega Institute for Medical Research, Katholieke Universiteit
Leuven, Leuven, Belgium
2Laboratory of Experimental Transplantation and 3Laboratory
of Histopathology, University Hospitals Leuven, Leuven, Belgium
The novel acyclic nucleoside phosphonate analogue 9-(2-phosphonylmethoxyethyl)-N6-cyclopropyl-2,6-diaminopurine (cPr-PMEDAP) was shown in vitro to act as an intracellular prodrug of 9-(2-phosphonylmethoxyethyl)guanine (PMEG). We compared the in vivo antitumor efficacy and selectivity of cPr-PMEDAP, its progenitor PMEDAP, and PMEG in a rat choriocarcinoma tumor model. The rats, inoculated with rat choriocarcinoma (RCHO) cells under the renal capsule, were treated IP during 10 days. Macroscopical and histological examination of the RCHO-inoculated kidneys was performed at two time points (i.e., immediately after the end of treatment or after an additional drug-free period of 2 weeks). Complete inhibition of choriocarcinoma tumor development was achieved upon treatment with cPr-PMEDAP, PMEG, and PMEDAP at a daily dose of 10, 1, and 50 mg/kg, respectively. At these doses, all three compounds produced moderate to strong toxicity (evidenced by atrophy of lymphoid organs and reduced body weight gain). When compared at the maximum tolerated (sublethal) doses (i.e., 0.5, 10, and 50 mg/kg for PMEG, cPr-PMEDAP, and PMEDAP, respectively), cPr-PMEDAP proved superior to PMEG and PMEDAP in achieving a complete inhibition of tumor development. Also, whereas PMEG was unable to produce a prolonged antitumor effect, the animals treated with cPr-PMEDAP still showed prominent inhibition of tumor development when tumor size was evaluated at 2 weeks after end of treatment. Based on its efficacy and therapeutic safety, cPr-PMEDAP can be regarded as a promising antitumor agent, which merits further in vivo evaluation in additional tumor models for human neoplasms.
Key words: Choriocarcinoma; Nucleotide analogue; Acyclic nucleoside phosphonate; Antitumoral; Prodrug
Address correspondence to Lieve Naesens, Rega Institute for Medical Research, Minderbroedersstraat 10, B-3000 Leuven, Belgium. Tel. +32-16-337345; Fax +32-16-337340; E-mail: lieve.naesens@rega.kuleuven.ac.be
Oncology Research, Volume 11, pp. 205-212, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Intratumoral Angiogenesis: A New Prognostic Indicator for Stage I Endometrial Adenocarcinomas?
Alexandra Giatromanolaki,1 Efthimios Sivridis,1 Michael I. Koukourakis,2 Vassilios Georgoulias,2 Kevin C. Gatter,3 and Adrian L. Harris3
Tumour and Angiogenesis Research Group
1Department of Pathology, Democritus University of Thrace,
Alexandroupolis 68100, Greece
2Department of Radiotherapy and Oncology and Laboratory
of Cancer Biology
University Hospital of Iraklion, Iraklion 71110, Crete, Greece
3Departments of Cellular Science and ICRF Medical Oncology
Unit, Oxford Radcliffe Hospital, Headington, Oxford, OX3 7LJ, UK
The prognostic significance of three recently emerged parameters, namely intratumoral angiogenesis and the antiapoptotic proteins bcl-2 and mutant p53, was investigated in a series of 124 patients with endometrial adenocarcinomas of the endometrioid cell type. All patients were treated with total abdominal hysterectomy and bilateral oophorectomy, without node dissection. When deep myometrial invasion or advanced stage of disease was confirmed, adjuvant radiotherapy was given. Intratumoral angiogenesis was assessed in tissue samples, after immunohistochemical staining, with the anti-CD31 monoclonal antibody. The mean microvessel density (MVD) was 23.2 ± 14.1 (range 4-60; 95% CI 20-25.8). Microvessel density was high (>30) in 30% of endometrial adenocarcinomas, medium (15-30) in 33% of the tumors, and low (<15) in the remaining cases (37%). A strong cytoplasmic and/or perinuclear expression of bcl-2 in more than 10% of the neoplastic cells was considered as being positive, and noted in 35.5% of the endometrial neoplasms; it was more frequent in the less vascularized carcinomas (P = 0.03). Nuclear p53 accumulation in an equal percentage of neoplastic cells (>10%) was less common (7.2%). In univariate analysis, early stage of disease, absence of lymphatic-vascular space invasion (LVI), and low intratumoral MVD were the parameters associated with an improved survival (P = 0.0001, P = 0.001, and P = 0.009, respectively). In multivariate analysis, however, the only independent variable noted was stage of disease (P < 0.0001). Within stage I endometrial adenocarcinomas, only intratumoral angiogenesis was associated with prognosis (univariate analysis): high MVD cases had a significantly worse prognosis compared to medium MVD (P = 0.02). Low MVD adenocarcinomas, on the other hand, were associated with an intermediate prognosis, indicating that other factors, such as hypoxia and related mechanisms, may also be important. It is suggested that intratumoral angiogenesis may prove useful in selecting a subgroup of cancer patients, among others with stage I endometrial disease, that would benefit from additional treatment.
Key words: Endometrial adenocarcinoma; Angiogenesis; bcl-2; p53
Address correspondence to Dr. Alexandra Giatromanolaki, Tumour and Angiogenesis Research Group, 18 Dimokratias Avenue, Iraklion 71306, Crete, Greece. Tel: 081-284661, 392498; Fax: 081-392848; E-mail: targ@her.forthnet.gr
Oncology Research, Volume 11, pp. 213-218, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Characteristics of Human T-Lymphotropic Virus Type-1 (HTLV-1)-Infected Cell Line MT-2, Which Is Not Killed by a Natural Killer Cell Line NK-92 But Is Killed by Lymphokine-Activated Killer Cells
Fumio Komatsu and Sayaka Yoshida
Blood Transfusion Service, School of Medicine, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyoku, Tokyo 113-8519, Japan
Natural killer (NK) cell-mediated cytolysis (NK-lysis) is triggered by costimulatory signals of adhesion molecules and is downregulated by negative signals of killer cell inhibitory receptors (KIRs). Recently, a NK cell line, NK-92, was established. This cell line can kill several tumor cells, which possess adhesion molecules CD54 and CD102. However, the NK-92 cannot kill a human T-lymphotropic virus type 1 (HTLV-1)-infected cell line, MT-2, although lymphokine-activated killer (LAK) cells can kill MT-2. In this report we investigated the reason for LAK sensitivity but NK-92 resistance of the MT-2. The MT-2 highly expressed CD54 and CD102, suggesting that the costimulatory signals may be intact. Then we tested the responsibility of the negative signals by determining HLA type of the MT-2 and KIRs of the effector cells. The MT-2 expressed HLA-A24, B40, B51, Cw3, and HLA-G. The NK-92 did not express KIR2DL1, KIR2DL2,3, nor KIR3DL1, but 24% of the cells weakly expressed CD94. The blocking tests against these HLA class I molecules and KIRs did not restore the NK-92 resistance, although blocking against HLA-G slightly increased its lysis. Finally, in order to eliminate the class I molecules from the cell surface, we treated the MT-2 using a buffered citric acid solution (pH 3.8). By using this treatment, the expression of class I molecules and HTLV-1 antigen decreased, and then the MT-2 was killed by the NK-92. These findings suggest that an aberrant class I molecule of the MT-2 transferred a negative signal to the NK-92 and induced the NK-92 resistance. It remains to be elucidated whether or not the HTLV-1 infection contributed to the alteration of the class I molecule.
Key words: MT-2; NK-92; Lymphokine-activated killer (LAK); Human T-lymphotropic virus type 1 (HTLV-1); Natural killer cell inhibitory receptor
Address correspondence to Fumio Komatsu, M.D., Blood Transfusion Service, School of Medicine, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyoku, Tokyo 113-8519, Japan. Tel: 81-3-5803-5645, Fax: 81-3-5803-5647.
Oncology Research, Volume 11, pp. 219-224, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Therapeutic Efficacy of a New Topoisomerase I and II Inhibitor TAS-103, Against Both P-Glycoprotein-Expressing and -Nonexpressing Drug-Resistant Human Small-Cell Lung Cancer
Prahlad Parajuli,1 Seiji Yano,1 Yasuhiko Nishioka,1 Hiroshi Nokihara,1 Masaki Hanibuchi,1 Naoki Nishimura,1 Teruhiro Utsugi,2 and Saburo Sone1
1Third Department of Internal Medicine, University of Tokushima
School of Medicine, Tokushima 770-8503, Japan
2Taiho Pharmaceutical Co. Ltd., Hanno Research Center, 1-27
Misugidai, Hanno, Saitama 357, Japan
We examined the effect of a novel topoisomerase I and II (topo I and II) inhibitor, TAS-103, on P-glycoprotein (P-gp)-expressing and -nonexpressing drug-resistant human small-cell lung cancer (SCLC) cells in vitro and in vivo. We observed that TAS-103 was effective in inhibiting in vitro proliferation of human SCLC (SBC-3 and H69) cells and their drug-resistant variants SBC-3/ADM or SBC-3/CDDP and H-69/VP, respectively. SBC-3/ADM and H-69/VP expressed high P-gp, whereas SBC-3/CDDP did not. TAS-103 also effectively reduced the tumor growth (more than 50% inhibition) of the parental as well as MDR SCLC cells grown SC in nude mice. Adriamycin (ADM) and cisplatin (CDDP), on the other hand, were effective only against the parental cells, while these drugs failed to inhibit the respective drug-resistant variants in vitro or in vivo. TAS-103 was observed to induce apoptosis dose dependently in the parental as well as drug-resistant SCLC cells as analyzed after 48 h of in vitro treatment, suggesting that the stabilization of cleavable topo I\n\ or II\n\DNA complexes by topo I and II inhibitors like TAS-103 is followed by apoptosis of the cells. Overall, our study suggests that TAS-103 may have clinical application against drug-resistant human SCLC.
Key words: TAS-103; Topoisomerase inhibitor; Lung cancer; Multidrug resistance; Apoptosis
Address correspondence to Saburo Sone, M.D., Ph.D., Professor and Chairman of Third Department of Internal Medicine, University of Tokushima School of Medicine, Tokushima 770-8503, Japan. Tel: +81-886-33-7127; Fax: +81-886-33-2134; E-mail ssone@clin.med.tokushima-u.ac.jp
Oncology Research, Volume 11, pp. 225-232, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Anticancer Potential of Cleistanthin A Isolated From the Tropical Plant Cleistanthus collinus
Chhalliyil P. Pradheepkumar and Govindaswamy Shanmugam
Cancer Biology Division, School of Biological Sciences, Madurai Kamaraj University, Madurai-625 021, India
A diphyllin glycoside called cleistanthin A was isolated from the tropical plant Cleistanthus collinus and its anticancer potential was assessed. This compound showed preferential cytotoxicity in several tumor cell lines. The GI50 values for normal cell lines were between 10-6 and 10-7 M while for tumor cells the values ranged from 10-7 to 10-9 M. When the cytotoxicity of this compound was compared with five anticancer drugs, cleistanthin A was found to be most effective for the oral carcinoma cell line KB and the cervical carcinoma cell line SiHa. The efficacy of cleistanthin A in arresting tumor growth was assessed in mice harboring Dalton's ascites lymphoma and a solid tumor S-180 sarcoma. In both cases, the tumor volume was drastically reduced upon treatment with cleistanthin A. This compound also increased the life span of mice with S-180 sarcoma to a similar extent as that done by cisplatin (CDDP: cis-diamminedichloroplatinum) and etoposide. However, cleistanthin A was less toxic than these drugs because it did not affect the body weight and lymphocyte count in treated animals. Although the molecular mechanisms of action of cleistanthin A in arresting cell growth are yet to be explored in various perspectives, our present results indicate that this compound arrests growth by inhibiting DNA synthesis and cell division and by driving cells to apoptosis. Time-lapse video microscopic recordings of cleistanthin A-treated cells showed vigorous membrane blebbing, characteristic of apoptosis.
Key words: Cleistanthin A; Anticancer effects; Apoptosis
Address correspondence to G. Shanmugam, School of Biological Sciences, Madurai Kamaraj University, Madurai-625 021, India. Tel: 91(452) 859126; Fax: 91(452) 858228; E-mail: bioldsa@pronet.net.in
Oncology Research, Volume 11, pp. 233-2421, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Carbohydrate Epitopes and Mucins Expressed by 17 Human Ovarian Carcinoma Cell Lines
Yutaka Tamada,1,2 Shin-ichiro Iida,2 Daisuke Aoki,1 Shiro Nozawa,1 and Tatsuro Irimura2
1Department of Obstetrics and Gynecology, School of Medicine,
Keio University, Tokyo 160-8582, Japan
2Laboratory of Cancer Biology and Molecular Immunology,
Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo
113-0033, Japan
Ovarian carcinomas are known to be diverse in their histological types and response to therapeutic agents. Specific immunotherapy by the use of mucins or carbohydrate vaccines has been attempted, in which expression of these epitopes by each histotype should clearly be assessed. Seventeen human ovarian carcinoma cell lines were evaluated for their expression of mucin core polypeptide mRNAs (MUC1, MUC2, MUC3, MUC5AC, MUC5B, and MUC6) by the reverse transcription-polymerase chain reaction. They were also examined for their expression of mucin-associated carbohydrate epitopes by flow cytometry. Eleven monoclonal antibodies, including those specific for Lewis antigen-related epitopes and Tn-related epitopes, were used. Expression of the MUC1 gene and sialyl Lewis X was characteristic to all five cell lines derived from clear cell adenocarcinomas. Multiple mucin genes and a diverse range of carbohydrate epitopes were observed with all six cell lines derived from mucinous adenocarcinomas. Mucin-associated carbohydrate epitopes were not detected on three of four serous adenocarcinoma cell lines, although MUC1 and MUC2 mRNAs were detected in all of them. Therefore, ovarian carcinoma cells from tumors of different histological types showed characteristic expression patterns of mucin genes and carbohydrate epitopes.
Key words: Ovarian carcinoma; Mucins; Carbohydrate epitope; Prognosis; Monoclonal antibody; Reverse transcription-polymerase chain reaction
Address correspondence to Tatsuro Irimura, Ph.D., Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. Tel: +81(3)5841-4870; Fax: +81(3)5841-4879; E-mail: irimura@mol.f.u-tokyo.ac.jp
Oncology Research, Volume 11, pp. 243-247, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved.
Ribavirin and Quercetin Synergistically Downregulate Signal Transduction and Are Cytotoxic in Human Ovarian Carcinoma Cells
W. Li,1,2 F. Shen,2 and G. Weber2
1The Walther Oncology Center and the 2Laboratory for Experimental Oncology, Indiana University School of Medicine, Indianapolis, IN 46202-5119
Ribavirin, a nucleoside, well known as a broad-spectrum antiviral agent, is extensively used in the treatment of hepatitis C infections. Ribavirin inhibits IMP DH (EC 1.1.1.205) activity and reduces cellular GTP concentration. Quercetin, a plant flavonoid, exhibits antineoplastic activity and inhibits PI 4-kinase (EC 2.7.1.67) and PIP 5-kinase (EC 2.7.1.68) activity. Ribavirin and quercetin attack the cell cycle at the G1 and G1/S boundary, respectively. Because they act on different enzyme targets and arrest the cell cycle at different phases, we tested the hypothesis that ribavirin and quercetin might be synergistic in growth inhibition and cytotoxicity. Human myeloma 8226 and human ovarian carcinoma OVCAR-5 cells were studied because in these cells IMP DH activity increased 14- and 20-fold, respectively, and PI 4- and PIP 5-kinase activities were also elevated. In growth inhibition for ribavirin and quercetin in myeloma 8226 cells IC50s were 40 and 70 mM, respectively. In OVCAR-5 cells in growth inhibition and clonogenic assays for ribavirin IC50 and LC50 of 35 and 23 mM, respectively, were observed. When quercetin was added 24 h after ribavirin, synergistic antiproliferative action was observed in both myeloma 8226 and OVCAR-5 cells. Synergistic action was also obtained in OVCAR-5 cells in clonogenic assay when ribavirin was combined with quercetin in the sequence described above. The mechanism of action is provided, in part at least, by the synergistic reduction of signal transduction (IP3 concentration) by ribavirin and quercetin. Ribavirin and quercetin in combination might be of interest in the treatment of myeloma and ovarian carcinoma.
Key words: Ribavirin; IMP DH; Quercetin; Signal transduction; IP3; Cell cycle; Human myeloma 8226 cells; Human ovarian carcinoma OVCAR-5 cells; Cytotoxicity
Address correspondence to G. Weber, Laboratory for Experimental Oncology, Indiana University School of Medicine, 699 West Drive, Indianapolis, IN 46202-5119. Tel: (317) 274-7921; Fax: (317) 274-3939; E-mail: gweber1@iupui.edu
Oncology Research, Volume 11, pp. 249-254, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved
Inhibition of the Action of the Topoisomerase II Poison Amsacrine by Simple Aniline Derivatives: Evidence for Drug-Protein Interactions
Graeme J. Finlay, Graham J. Atwell, and Bruce C. Baguley
Auckland Cancer Society Research Centre, University of Auckland School of Medicine, Auckland, New Zealand
The action of the anticancer drug amsacrine appears to involve molecular interactions with both DNA and topoisomerase II. It has been shown previously that DNA intercalators can inhibit the action of amsacrine and several other topoisomerase II poisons, presumably as a result of interference with the DNA binding sites for the enzyme. We show here that drug molecules such as N-phenylmethanesulfonamide, which mimic the anilino side chain of amsacrine, inhibit the cytotoxicity against cultured Lewis lung murine carcinoma of amsacrine, amsacrine analogues including asulacrine and DACA (N-[2-(dimethylamino)-ethyl]acridine-4-carboxamide dihydrochloride), and etoposide. In contrast, the cytotoxicity of doxorubicin was slightly increased by co-incubation with N-phenylmethanesulfonamide. The cytotoxicity of amsacrine was also modulated in human Jurkat leukemia, HCT-8 colon, and HT-29 colon cell lines. Because o-AMSA, an amsacrine analogue containing a methoxy group in the ortho rather than in the meta position, is known to be inactive as an antitumor drug, the abilities of the ortho and meta methoxy-substituted derivatives of methyl-N-phenylcarbamate to reverse the cytotoxicity of amsacrine, asulacrine, and DACA were compared. The ortho substitution decreased activity while meta substitution slightly increased it, suggesting that the side chains were binding to a similar site to that occupied by amsacrine. To determine whether the side chain variants actively inhibited the formation of DNA-topoisomerase II covalent complexes, cultured cells were treated with amsacrine or asulacrine, harvested, and lysed directly on acrylamide gels before electrophoresis and Western blotting to identify non-DNA-bound topoisomerase II. Extractable topoisomerase II was depleted in cells incubated with amsacrine but partially restored by coculture with methyl-N-phenylcarbamate. The findings are consistent with the hypothesis that low molecular weight molecules can modulate the effects of topoisomerase II poisons by directly interacting with the enzyme.
Key words: Topoisomerase II; Doxorubicin; Amsacrine; Cell cycle
Address correspondence to Graeme J. Finlay, Auckland Cancer Society Research Centre, University of Auckland School of Medicine, Private Bag 92019, Auckland 1000, New Zealand. Tel: (64-9) 3737-599, Ext. 6140; Fax: (64-9) 3737-502; E-mail: g.finlay@auckland.ac.nz
Oncology Research, Volume 11, pp. 255-264, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved
The Protective Effect of Estrogen Against Chemically Induced Murine Colon Carcinogenesis Is Associated With Decreased CpG Island Methylation and Increased mRNA and Protein Expression of the Colonic Vitamin D Receptor
Patricia Smirnoff,1 Yair Liel,2,4 Julia Gnainsky,1 Shraga Shany,3,4 and Betty Schwartz1
1Institute of Biochemistry, Food Sciences and Nutrition,
Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew
University of Jerusalem, Rehovot, Israel
2Endocrine Unit, 3Clinical Biochemistry Unit,
and 4Soroka Medical Center and the Faculty of Health Sciences,
Ben-Gurion University of the Negev, Beer-Sheva, Israel
Epidemiological studies suggest that estrogen prevents neoplastic transformation in the intestinal mucosa. Estrogen was shown to increase the expression of vitamin D receptors (VDR) in a variety of tissues. 1,25-Dihydroxyvitamin D [1,25-(OH)2D] and several of its analogues are known as potent antineoplastic and prodifferentiative in many cell types, including colon-derived cells. The present study was designed to examine the effect of estradiol (E2) on dimethylhydrazine (DMH)-induced colon cancer in rats, and the possibility that E2 may exert its protective effect on the colon through modulation of the vitamin D/endocrine system. The in vivo effect of E2 on DMH-induced colorectal cancer was studied in four groups of ovariectomized female rats: (I) untreated control, (II) E2 treated, (III) DMH treated, and (IV) combined E2 and DMH treated. Significantly higher uterine weights and higher colonic estrogen receptor content confirmed the effectiveness of ovariectomy and E2 replacement. The number of malignant tumors in group IV was 2.3 ± 1.1 (mean ± SE) per rat, compared with 8.1 ± 1.9 in group III (P < 0.001). Exposure to estrogen was associated with a marked increase in VDR mRNA content and VDR protein expression in the normal colonic mucosa. In tumor extracts VDR protein expression was considerably lower compared with normal mucosa. Estrogen treatment did not affect serum levels of 25(OH)D, 1,25(OH)2D, and PTH. Significant CpG island methylation in the VDR gene was observed in colonic tissue DNA harvested from rats treated with DMH, but not in colonic mucosae from rats treated with DMH + E2. The highest frequency of CpG methylation in the VDR gene was detected in DNA extracted from cancer tissue rims. In summary, the protective effect of estrogen against chemically induced colonic carcinogenesis is associated with reduced methylation of the VDR gene and with upregulation of both VDR gene transcription and protein expression. We suggest that estrogen may interfere with the process of CpG DNA methylation in the colonic mucosa to prevent silencing of the VDR gene. Increased VDR activity could be one of the mechanisms by which estrogen protects against neoplastic transformation in the colon.
Key words: Vitamin D; Estrogen; Colorectal cancer; DNA methylation; Steroid receptors
Address correspondence to Dr. Betty Schwartz, Department of Biochemistry and Nutrition, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot 76100, Israel. Tel: +972-8-948-9007; Fax: +972-8-947-6189; E-mail: bschwart@agri.huji.ac.il
Oncology Research, Volume 11, pp.265-271, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved
Influence of Static Magnetic Field on the Antiproliferative Effects of Vitamin D on Human Breast Cancer Cells
Stefania Pacini,1 Stefano Aterini,2 Paolo Pacini,1 Carla Ruggiero,3 Massimo Gulisano,1 and Marco Ruggiero1,2
1Department of Anatomy, Histology and Forensic Medicine, 2Department of Experimental Pathology and Oncology, 3Department of Clinical Physiopathology, University of Firenze at the Careggi General Hospital, Viale Morgagni, I-50134 Firenze, Italy
We describe the effect of a 0.2 tesla (T) static magnetic field generated by a magnetic resonance tomograph and of vitamin D treatment on a human breast cancer cell line (MCF-7). Cell damage and proliferation were monitored by measuring the incorporation of [3H]thymidine in duplicating DNA and by the clonogenic assay. [3H]Thymidine incorporation in MCF-7 was stimulated by vitamin D at low doses (10-12-10-10 M), whereas it was inhibited at higher concentrations (10-9-10-6 M). Magnetic field treatment (0.2 T) decreased [3H]thymidine incorporation in human breast cancer cells, eliminating the proproliferative effect of low doses of vitamin D, and enhanced the vitamin D antiproliferative effect, further reducing [3H]thymidine incorporation, from -12.5% (P < 0.05) to -66.7% (P < 0.001), over the range of 10-9 to 10-6 M. In the clonogenic assay, ability of MCF-7 to form colonies was inhibited by vitamin D 10-9 M and above, whereas 3-h exposure to 0.2 T magnetic field had no effect on the number of cell colonies formed. In conclusion, vitamin D treatment yields a permanent antiproliferative effect, while magnetic field exposure only temporarily slows down cellular growth. These findings suggest that therapy with vitamin D may prove beneficial for chemoprevention or treatment of breast cancer. Static magnetic field, alone or in combination, does not appear to represent an effective candidate for breast cancer therapy, at least at the intensity used in the present study.
Key words: Vitamin D; Electromagnetic fields; Breast cancer; Neoplasms
Address correspondence to Prof. Marco Ruggiero, Department of Experimental Pathology and Oncology, Viale Morgagni 50, 50134 Firenze, Italy. Tel: +39 055-411131; Fax: +39 055-416908; E-mail: SIVISPACEM@YAHOO.COM
Oncology Research, Volume 11, pp. 273-280, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved
Growth Inhibition of a Human Ovarian Tumor by a Novel Paclitaxel Derivative in SCID Mice
Imran Ahmad, Gregg R. Masters, James J. Schupsky, Josephine Nguyen, Shaukat Ali, Andrew S. Janoff, and Eric Mayhew
The Liposome Company Inc., One Research Way, Princeton, NJ 08540
We report here the toxicity and therapeutic effects of 2'-a-bromohexadecanoyl paclitaxel (BrC16HT), a prodrug form of paclitaxel, in mice. Paclitaxel is the active ingredient of Taxol®. The maximum tolerated dose, at a one dose per day for 5-day schedule, was 37.5 mg/kg for BrC16HT compared to 12.5 for Taxol® administered IP, and was 12.5-25 mg/kg for either agent administered IV. Dose-dependent therapeutic effects were found for BrC16HT against a human ovarian tumor (OVCAR-3) grown in SCID mice. IP treatments with BrC16HT against early or established IP-implanted OVCAR-3 tumor increased mean survival times more than treatment with Taxol®. Long-term survivors were found only in groups treated with BrC16HT. Intravenously administered BrC16HT was more effective than Taxol® against SC OVCAR-3 tumor. Early treatment (25 mg/kg ´ 5) completely inhibited tumor growth through 120 days after tumor implantation. Pharmacokinetic studies suggest that BrC16HT is slowly hydrolyzed to paclitaxel and circulates longer than paclitaxel from Taxol®. Thus, BrC16HT may provide sustained levels of paclitaxel, which may contribute to the increased efficacy of BrC16HT compared to Taxol®.
Key words: Taxol®; Cremophor® EL; Toxicity; Therapeutics; Human tumor models; Xenografts
Address correspondence to Imran Ahmad, The Liposome Company Inc., One Research Way, Princeton, NJ 08540. Tel: (609) 452-7061; Fax: (609) 520-8250.
Oncology Research, Volume 11, pp. 281-285, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved
Identification of Seven Genes Regulated by Wild-Type p53 in a Colon Cancer Cell Line Carrying a Well-Controlled Wild-Type p53 Expression System
Shu Okamura,1,2 Ching C. Ng,1 Kumiko Koyama,1 Yoshiki Takei,1 Hirofumi Arakawa,1 Morito Monden,2 and Yusuke Nakamura1
1Laboratory of Molecular Medicine, Human Genome Center, Institute
of Medical Science, The University of Tokyo, 4-6-1, Shirokanedai, Minato-ku,
Tokyo 108-8639, Japan
2Department of Surgery II, Osaka University Medical School,
2-2 Yamadaoka, Suita 565-0871, Japan
We applied a differential display method to screen mRNAs isolated from a newly established cell line that carried a wild-type p53 transgene under control of the lactose operon. To investigate the p53 signaling pathway, we looked for genes whose expression was significantly induced or suppressed by induction of wild-type p53 protein, and identified seven. DNA sequence analyses revealed that the two genes that were upregulated encoded isozyme 6 of aldehyde dehydrogenase (ALDH6) and subunit I of cytochrome c oxidase (COI). The five genes that were downregulated encoded protein-tyrosine kinase (Syk), high mobility group chromosomal protein 17 (HMG-17), transferrin receptor, human alpha-tubulin, and sds22-like protein. The results indicated that genes related to cell cycle regulation, cell respiration, and cytoskeletal structure are involved in the process of growth arrest induced by wild-type p53.
Key words: p53; p53 target gene; Differential display
Address correspondence to Yusuke Nakamura, M.D., Ph.D., Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, 4-6-1, Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Tel: 81-3-5449-5372; Fax: 81-3-5449-5433; E-mail: yusuke@ims.u-tokyo.ac.jp
Oncology Research, Volume 11, pp. 287-293, 1999
0965-0407/99 $10.00 + .00
Copyright © 1999 Cognizant Comm. Corp.
Printed in the USA. All rights reserved
Neuroprotective Interactions in Rats Between Paclitaxel and Cisplatin
Mark J. McKeage,1 Gabi G. Haddad,1 Li Ding,1 Peter Galettis,1 Daniela Screnci,1 Li Zhuang,2 and Bruce C. Baguley2
1Department of Pharmacology and Clinical Pharmacology, Faculty of Medicine and Health Sciences, University of Auckland, Auckland, New Zealand
2Auckland Cancer Society Research Centre, Faculty of Medicine and Health Sciences, University of Auckland, Auckland, New Zealand
Paclitaxel and cisplatin are associated with dose-limiting neurotoxicity that may result from their differing effects on microtubule stability in peripheral nerves. We hypothesized that such different actions of paclitaxel and cisplatin could be exploited to minimize their neurotoxicity by giving them in combination. Paclitaxel (9-18 mmol/kg/week or 7.7-15.4 mg/kg/week) and cisplatin (5-10 mmol/kg/week or 1.5-3 mg/kg/week) were given alone and in combination to female Wistar rats. Treatment was given once per week for a total of 7-10 weeks. Paclitaxel and cisplatin were given 24 h apart when they were given in combination. Changes in sensory nerve conduction velocity (SNCV) and dorsal root ganglia (DRG) morphology were measured. The nature of their interaction was analyzed using an isobologram. Their antitumor activity alone or in combination was also determined in C57Bl/6 mice bearing colon 38 tumors. Reductions in SNCV occurred with paclitaxel alone (P = 0.009), cisplatin alone (P = 0.012), and cisplatin given 24 h before paclitaxel (P < 0.0001). In contrast, there was no significant change in SNCV with paclitaxel given 24 h before cisplatin (P = 0.11). An isobologram showed that the SNCV effects of the drug combinations were less than additive or antagonistic. Cisplatin-induced morphometric changes in DRG neurons were less marked when cisplatin was given with paclitaxel (P = 0.004). Concentrations of platinum in dorsal root ganglia, sural nerves, and sciatic nerves were not altered by giving paclitaxel before cisplatin. Tumor growth delays (TGD) were greater after treatment with paclitaxel (23.4 mmol/kg or 20 mg/kg) given 24 h before cisplatin (23.3 mmol/kg or 7 mg/kg) (TGD = 7.5 days) than after paclitaxel (23.4 mmol/kg or 20 mg/kg) (TGD = 2.0 days) or cisplatin (23.3 mmol/kg or 7 mg/kg) (TGD = 3.5 days) alone. Paclitaxel and cisplatin antagonized each other's neurotoxicity in Wistar rats. Combining cytotoxic agents with opposing effects on peripheral nerves has potential for minimizing neurotoxicity in patients.
Key words: Platinums; Taxanes; Neurotoxicity; Drug interactions
Address correspondence to Dr. Mark J. McKeage, Department of Pharmacology and Clinical Pharmacology, Faculty of Medicine and Health Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand. Tel: (64 9) 373 7599, ext. 7322; Fax: (64 9) 373 7556; E-mail: m.mckeage@auckland.ac.nz
Microsatellite Instability and Frameshift Mutations in Genes Involved in Cell Cycle Progression or Apoptosis in Ovarian Cancer
Anna Maria Codegoni,1 Francesco Bertoni,1 Gennaro Colella,1 Giovanna Caspani,2 Laura Grassi,2 Maurizio D'Incalci,1 and Massimo Broggini1
1Molecular Pharmacology Unit, Department of Oncology, Istituto
di Ricerche Farmacologiche "Mario Negri," Milan, Italy
2Ospedale S. Gerardo, University of Milan, Monza (MI), Italy
The loss of mismatch repair enzymes increases the mutation rate in microsatellites and coding regions of the genome and appears to be involved in drug resistance. The replication error (RER+) phenotype, associated with microsatellite instability, has been widely described for both familial and sporadic colon cancers and for gastric and endometrial tumors. For ovarian cancer, the incidence of RER+ cases among sporadic tumors is still uncertain. We analyzed epithelial ovarian tumors and ovarian carcinoma cell lines for microsatellite instability and for mutations in the coding regions of different genes, including the recently discovered human CHK-1 gene, which has an important role in controlling cell cycle progression and whose coding region contains a poly(A)9 tract. Microsatellite instability and frameshift mutations in coding regions of BAX, TGFbRII, IGFIIR, E2F-4, ICE, and CHK-1 genes were analyzed in ovarian cancer samples and cell lines by polymerase chain reaction (PCR). Approximately 26% of patients showed microsatellite instability in two or more loci. BAT-26 locus showed no alteration in primary tumors. We detected a BAX mutation in one tumor sample and a TGFbRII mutation in one cell line. Our findings confirm the presence of the RER+ phenotype in sporadic ovarian cancer. The low rate of mutation in genes previously reported to be altered in colon and gastric cancer suggests that other not yet identified genes might be altered and could play a role in tumor progression and response to treatment in RER+ ovarian tumors.
Key words: Mutations; Ovarian cancer; Apoptosis; Cell cycle; Microsatellites
Address correspondence to Anna Maria Codegoni, Molecular Pharmacology Unit, Istituto di Ricerche Farmacologiche "Mario Negri," via Eritrea 62, 20157 Milan, Italy. Tel: ++39-0239014472; Fax: ++39-023546277.
Effects of Mitomycin C and Carboplatin Pretreatment on Multidrug Resistance-Associated P-Glycoprotein Expression and on Subsequent Suppression of Tumor Growth by Doxorubicin and Paclitaxel in Human Metastatic Breast Cancer Xenografted Nude Mice
Michael A. Ihnat, Angela M. Nervi, Stephen P. Anthony, Ronald C. Kaltreider, Amy J. Warren, Carrie A. Pesce, Stacey A. Davis, Jean P. Lariviere, and Joshua W. Hamilton
Department of Pharmacology and Toxicology, Dartmouth Medical School,
Hanover NH 03755-3835
Norris Cotton Cancer Center, Dartmouth-Hitchcock Medical Center, Lebanon
NH 03756-0001
Overexpression of P-glycoprotein (Pgp), multidrug resistance-associated protein (MRP), and several other proteins has been associated with development of multidrug resistance by cancer cells, which represents a significant obstacle to successful treatment by chemotherapy. We had previously demonstrated that a single noncytotoxic dose of mitomycin C (MMC), carboplatin, or one of several other DNA cross-linking agents suppressed mRNA expression of the mdr1 gene coding for Pgp, leading to a subsequent suppression of Pgp protein levels and a concomitant decrease in drug efflux. Pretreatment with MMC led to a 5- to 10-fold decrease in the ED50 for cell killing by a subsequent agent such as the Pgp substrate, doxorubicin, but did not affect killing by the non-Pgp substrate, cisplatin. In this study, we report that MMC and carboplatin each significantly suppressed Pgp protein levels in human MDA-MB-435 cells xenografted as solid tumors into the lateral mammary fat pads of female nude mice, with a similar time course as had previously been observed in cell culture. Pretreatment of mice with MMC or carboplatin 48-72 h prior to receiving either doxorubicin or paclitaxel caused a significantly greater reduction in tumor growth rate compared to either agent alone or the combination given simultaneously. These data suggest that a combination chemotherapy regimen consisting of a DNA cross-linking agent given to modulate the MDR phenotype, followed by a second cytotoxic agent, may be an effective treatment for human patients with de novo or late stage acquired multidrug-resistant malignancies.
Key words: P-glycoprotein; Cancer chemotherapy; MDA-MB-435 breast cancer cell line; Multidrug resistance; Gene expression
Address correspondence to Joshua W. Hamilton, Ph.D., Department of Pharmacology and Toxicology, 7650 Remsen, Dartmouth Medical School, Hanover, NH 03755-3835. Tel: (603) 650-1316; Fax: (603) 650-1129; E-mail: josh.hamilton@dartmouth.edu
c-erbB-2 mRNA in Breast Cancer Specimens That Exhibit Membrane or Cytoplasmic Immunoreactivity for c-erbB-2
Sue L. Taylor,1 Philip S. Rudland,1,2 and Roger Barraclough2
1Cancer Tissue Bank Research Centre,2School of Biological Sciences, University of Liverpool, P.O. Box 147, Liverpool, L69 7ZB, UK
Immunocytochemically detected membrane staining for c-erbB-2 in 20-30% of breast cancers correlates with a poorer prognosis for the patients. However, cytoplasmic immunoreactivity for c-erbB-2 has also been found in some specimens using some particular antisera, and it has been suggested that this staining arises from a protein located in the mitochondrial membrane. It is possible that this protein is an alternative form of c-erbB-2. In the present article, adjacent histological sections have been stained for c-erbB-2 immunocytochemically and for c-erbB-2 mRNA by in situ hybridization. The results show the absence of c-erbB-2 mRNA in regions of cancer specimens that exhibit cytoplasmic staining for c-erbB-2, strongly suggesting that cytoplasmic staining for c-erbB-2 is an immunocytochemical artefact.
Key words: c-erbB-2; Breast cancer; In situ hybridization; Immunocytochemistry; competitive PCR
Address correspondence to Dr. R. Barraclough, School of Biological Sciences, Life Sciences Building, University of Liverpool, Crown Street, P.O. Box 147, Liverpool, L69 7ZB, UK. Tel: 44 (0) 151 794 4327; Fax: 44 (0) 151 794 4349; E-mail: brb@liv.ac.uk
Establishment of a Quantitative Mouse Dorsal Air Sac Model and its Application to Evaluate a New Angiogenesis Inhibitor
Yasuhiro Funahashi, Toshiaki Wakabayashi, Taro Semba, Jiro Sonoda, Kyosuke Kitoh, and Kentaro Yoshimatsu
Tsukuba Research Laboratories, Eisai Co. Ltd., 1-3, Tokodai 5-chome, Tsukuba-shi, Ibaraki 300-2635, Japan
We have developed an improved mouse dorsal air sac model for quantifying in vivo tumor-induced angiogenesis. In our improved model, tumor angiogenesis is determined by measuring the blood volume in an area of skin held in contact with a tumor cell-containing chamber, using 51Cr-labeled red blood cells (RBC). The blood volume induced by murine B16-BL6 melanoma cells increased linearly with the cell number in the range from 2 x 105 to 5 x 106. Ten of 11 human tumor cell lines examined induced a significant increment in blood volume. For three representative human tumor cell lines (A549, WiDr, and HT1080 cells) that showed different angiogenic potencies, the levels of vascular endothelial growth factor (VEGF) produced by the tumor cells cultured under conditions of hypoxia and high cell density were correlated with the degree of in vivo angiogenesis. Using the improved model, it was confirmed that TNP-470, a well-known inhibitor, and borrelidin, an antibiotic from Streptomyces rochei, significantly inhibited the WiDr cell-induced angiogenesis. Borrelidin also inhibited spontaneous lung metastasis of B16-BL6 melanoma at the same dose that inhibited angiogenesis. Our results suggest that the improved mouse dorsal air sac model can be used for simple and quantitative measurement of tumor-induced angiogenesis and its inhibition.
Key words: Angiogenesis; In vivo model; VEGF; Quantification; Hypoxia; Borrelidin
Address correspondence to Yasuhiro Funahashi, Cancer Research Unit, Tsukuba Research Laboratories, Eisai Co., Ltd., 1-3 Tokodai 5-chome, Tsukuba-shi, Ibaraki 300-2635, Japan. Tel: (81) 298 47 5740; Fax: (81) 298 47 2037; E-mail: y-funahashi@hhc.eisai.co.jp
Sodium Butyrate Modulates p53 and Bcl-2 Expression in Human Retinoblastoma Cell Lines
Michele C. Madigan,1 Geeta Chaudhri,2 Philip L. Penfold,1 and Robert M. Conway1
Departments of 1Clinical Ophthalmology and 2Pathology, University of Sydney, NSW, Australia
Sodium butyrate (SB) is a potent biological modifier that can induce diverse effects including growth inhibition, differentiation, or apoptosis of many cell types including retinoblastoma (Rb), and modulation of genes such as c-fos and p53. In this study we assessed the effects of SB on cell growth and expression of p53, critical for cell cycle control, and Bcl-2, an inhibitor of apoptosis, in two human Rb cell lines (Y79 and WERI-Rb1). Attachment cultures were treated with 1 mM SB for up to 5 days and immunocytochemistry was used to examine for the expression of neural cell adhesion molecule (NCAM), p53, and Bcl-2. Suspension cultures of both cell lines were also treated with 1 and 4 mM SB, and at selected times cell extracts were prepared and the expression of p53 and Bcl-2 proteins determined by Western blot analysis. Treatment with 1 mM SB of both cell lines for 5 days inhibited growth and induced morphological changes including extension of neurite-like processes. Up to 12 h after 1 mM SB treatment, p53 and Bcl-2 expressions were similar to control levels, then gradually decreased to very low levels at 5 days. SB (4 mM) also inhibited growth associated with cell death, which was apparent at 24 h posttreatment. Expressions of p53 and Bcl-2 were decreased below control levels at 4 h, and by 24 h only very low levels of protein were detected. SB-induced modulation of p53 and Bcl-2 expression may have implications for controlling Rb growth, particularly in combination with chemotherapy drugs, which are increasingly used in the treatment of Rb.
Key words: Apoptosis; Differentiation; Growth inhibition; immunoblotting
Address correspondence to Michele C. Madigan, Ph.D., Department Clinical Ophthalmology, GPO Box 4337, Sydney NSW 2001 Australia. Tel: 61 2 9382 7283; Fax: 61 2 9382 7318; E-mail: michele@eye.usyd.edu.au
Natural Killer Cells as Potential Tools in Melanoma Metastatic Spread Control
Roberto Nasca1 and Ennio Carbone2,3
1Chair of Clinical Immunology, University of Naples, "Federico
II," Naples, Italy
2Microbiology and Tumorbiology Center, Karolinska Institutet,
Stockholm, Sweden
3Department of Biology and Pathology Cellular and Molecular
"L. Califano," University of Naples, "Federico II" Naples, Italy
A large basic knowledge is now available on natural killer (NK) cell biology in mice and humans. Intensive research during the 1990s has clarified many aspects on the specificity and receptors of NK cells. It is now possible to apply this knowledge to the study of NK cell responses in important medical problems. The general aim of this commentary is to focus the attention of clinical and basic immunologists and oncologists on the possible involvement of NK cells in new biologically oriented antitumor protocols. Here we comment on the more recent studies of NK cell recognition of melanoma cells, with particular emphasis on the NK-activating and -inhibiting receptors and their ligands regulating NK cytotoxicity.
Key words: Natural killer cells; Melanoma; Killer inhibitory receptor; MHC class I; CD40; Cytotoxicity
Address correspondence to Ennio Carbone, Microbiology and Tumorbiology Center, Karolinska Institutet, mbox 280, 171 77 Stockholm, Sweden. Tel: +46 8 7286769; Fax: +46 8 304276; E-mail: ennio.carbone@mtc.ki.se
Mechanisms Involved in the Potentiation of Melphalan by the Bioreductive Compound THNLA-1 In Vitro
Maria V. Papadopoulou,1 Ming Ji,1 Shariq H. Khan,2 and William D. Bloomer1
1The Radiation Medicine Institute and the 2Department of Medical Oncology at Evanston Northwestern Healthcare, 2650 Ridge Avenue, Evanston, IL 60201
9-[3-(2-Nitro-1-imidazolyl)propylamino]-1,2,3,4-tetrahydroacridine hydrochloride (THNLA-1) is a 2-nitroimidazole-based, weakly DNA-intercalating bioreductive agent that significantly potentiates the toxic effects of commonly used antitumor drugs such as melphalan (L-PAM) or cis-DDP in sensitive or resistant cell lines in culture, as well as in solid tumors in mice. Potentiation in vitro was observed when cells were preexposed to THNLA-1 under hypoxic conditions before exposure to L-PAM under aerobic conditions. In this study we investigated possible mechanisms involved in the potentiation of L-PAM by THNLA-1 in V79 Chinese hamster cells. Limited depletion of glutathione with buthionine sulfoximine or THNLA-1 under hypoxic pretreatment conditions accounted for only 8.3% of the potentiation induced by THNLA-1. However, DNA, RNA, and protein synthesis were inhibited in a synergistic way in cells preexposed to THNLA-1 under hypoxic conditions (2 h, 37°C) and then coexposed to various doses of \SC\L-PAM under aerobic conditions (1 h, 37°C). Cell cycle analysis by flow cytometry showed a slow traverse through the S phase in the L-PAM-alone-treated cells. However, this phenomenon was more prominent in the THNLA-1 plus L-PAM-treated cells. Under aerobic co-incubation conditions with L-PAM, no difference was observed in the cell cycle of \SC\L-PAM-alone-treated cells vs. THNLA-1 plus L-PAM-treated cells. Significantly increased apoptosis was observed in the hypoxia-pretreated cells with THNLA-1, 12 and 24 h posttreatment. Comet and alkaline elution assay analysis showed increased DNA cross-links in the hypoxia-pretreated cells with THNLA-1 compared to the L-PAM-alone-treated cells. Finally, potential lethal damage repair was totally suppressed only in the hypoxia-pretreated cells with THNLA-1. In conclusion, DNA damage and hindrance in its repair are the most important mechanisms in the potentiation of L-PAM by THNLA-1, under hypoxic pretreatment conditions.
Key words: THNLA-1; Bioreductive drugs; Potentiation; Chemotherapy; Mechanisms
Address correspondence to Maria V. Papadopoulou, Ph.D., The Radiation Medicine Institute, Evanston Northwestern Healthcare, 2650 Ridge Avenue, Evanston, IL 60201. Tel: (847) 570-2262; Fax: 847-570-1878; E-mail: mvp499@anima.nums.nwu.edu.
Morphologic Aspect of the Placenta in Young and Adult Pregnant Rats Bearing Walker 256 Carcinoma
Mércia Tancredo Toledo and Maria Cristina Cintra Gomes-Marcondes
Department of Physiology and Biophysics, Institute of Biology, University of Campinas, UNICAMP, 13083-970, Campinas, SP Brazil
In the present study we investigated the influence of Walker 256 tumor growth on the modification of placental morphology and on fetal development in young and adult pregnant rats. After mating, female rats were divided into six groups: young control pregnant (Y), young pregnant with tumor (Yw), young pregnant injected with ascitic fluid (Ya), adult control pregnant (A), adult pregnant with tumor (Aw), and adult pregnant injected with ascitc fluid (Aa). Rats from tumor-bearing groups (Yw and Aw) were injected with 2.5 x 106 viable tumor cells into the right flank. Rats from Ya and Aa groups received daily inoculations of ascitic fluid (2.0 ml, IP) obtained from tumor-bearing rats without tumor cells. After 21 days, all animals were killed and the placentas were weighed and fixed with paraformaldehyde for histological analysis. Compared with control groups (Y and A), both tumor-bearing groups (Yw and Aw) presented the following changes: i) hemorrhage in the decidua and in the trophoblast giant cell layer; ii) disarrangement of the spongy zone, iii) restricted delimitation of the maternal and fetal blood vessels in the placental labyrinth; iv) hemorrhage and edema in the placental labyrinth. Similar results were observed in the placenta of groups injected with ascitic fluid (Ya and Aa). These results indicate that tumor development during pregnancy can have deleterious effects on placenta and fetus. These observations extend our previous data of extensive fetal reabsorption in both pregnant tumor-bearing and ascitic fluid-injected animals. These changes in placental morphology may be related to the synthesis and release of some factors by the tumor and the host cells, which could act directly or indirectly on placental tissue.
Key words: Walker 256 tumor; Pregnancy; Placenta
Address correspondence to Maria Cristina Cintra Gomes-Marcondes at her present address: Department of Pharmaceutical & Biological Sciences, Pharmacy School, Aston University, Aston Triangle, Birmingham B4 7ET, UK. Fax: +44 0121 333 3172; E-mail: m.c.c.g.marcondes@aston.ac.uk
Comparison of Flow Cytometry and RT-PCR for the Detection of Ovarian Cancer Cells in Peripheral Blood
Margit Stimpfl,1 Bernd C. Schmid,1 Andreas Obermair,1 Dan Tong,1 Ingrid Schiebel,1 Gerald Gitsch,1 Sepp Leodolter,1,2 and Robert Zeillinger1
1Division of Gynecology, Molecular Oncology Group, Department
of Obstetrics and Gynecology, University of Vienna, Waehringer Guertel
18-20, A-1090 Vienna, Austria
2Ludwig-Boltzmann Institute for Gynaecological Oncology
and Reproductive Medicine, Waehringer Guertel 18-20, A-1090 Vienna, Austria
Recently, there has been significant effort in developing techniques designed to detect disseminated tumor cells in the peripheral blood (PB). These techniques include immunocytochemical staining of cytocentrifuge slides, flow cytometry, and RT-PCR. Several authors reported various results concerning the sensitivity of the detection limit when applying these methods. The aim of this study was to assess the value of two methods in the detection of ovarian carcinoma cells in the PB. For tumor cell detection we compared RT-PCR to immunomagnetic enrichment followed by flow cytometric analysis. In a model system, single cell suspensions of ovarian cancer cell lines were mixed with full blood samples from healthy donors in order to determine the sensitivity limit of the two methods and to analyze the reproducibility of each. In a multiparameter flow cytometric analysis, tumor cells were defined as cytokeratin 7/8 positive and CD45 negative. RNA was screened for MUC1 mRNA by RT-PCR. MUC1 mRNA expression turned out not to be a specific marker of disseminated ovarian cancer cells, because a weak expression was also found in samples of healthy persons. Using immunomagnetic enrichment followed by flow cytometry, one carcinoma cell per 1 x 106 leukocytes was detectable. However, a minimum of 10 ml blood had to be analyzed in order to clearly distinguish real positive tumor cells from false-positive signals.
Key words: Immunomagnetic separation; Epithelial markers; Evaluation of detection methods
Address correspondence to Robert Zeillinger, Department of Obstetrics and Gynecology, Division of Gynecology, Molecular Oncology Group, University of Vienna, Waehringer Guertel 18-20, EBO 05Q, A-1090 Vienna, Austria. Tel: +43-1-40400-7831; Fax: +43-1-40400-7832; E-mail: robert.zeillinger@akh-wien.ac.at
Influence of the Fluoroquinolone Ofloxacin on the Intrinsic Expression of Multidrug Resistance Phenotype in HCT-8 Human Colon Carcinoma Cells
Sophie Marchal,1 Jean-Louis Merlin,1 Pascal Colosetti,1 and Chantal Finance2
1Centre Alexis Vautrin, Laboratoire de Recherche en Oncologie,
Vandoeuvre les Nancy, France
2UMR UHP-CNRS 7565, GEVSM Microbiologie Moléculaire,
Faculté‚ de Pharmacie Université Henri Poincaré‚ Nancy
1, Nancy, France
The influence of antibiotics, particularly ofloxacin (OF), a commonly used antimicrobial fluoroquinolone, on the multidrug resistance (MDR) phenotype of the HCT-8 cell line was studied. This cell line was grown in OF containing medium for several months and the expression of the MDR phenotype was followed through the analysis of the expression and functionality of the P-glycoprotein (Pgp), the chemosensitivity to daunorubicin (DNR), and the mRNA expression of mdr-1, multidrug resistance-associated protein (MRP), and topoisomerase IIa and IIb genes. Replacement of OF by penicillin-streptomycin (PS) resulted in a significant decrease in mdr-1 mRNA expression, which was found to correlate with a decrease in the expression and functionality of the Pgp. After antibiotic starvation for 4 weeks, cells grown in antibiotic-free medium were then exposed to PS or OF; these cells showed an increase in mdr-1 mRNA/Pgp and MRP mRNA expression without a decrease in DNR cytotoxicity. OF cultured cells exhibited a significant increase in Pgp expression without evidence of the functionality of the Pgp. An increase in topoisomerase IIa mRNA expression was observed with time and with the number of passages of the cell line without any relationship to the presence of antibiotics in the culture medium. These results showed that extensive use of antibiotics, particularly the quinolones, can modify the phenotype of the HCT-8 colon adenocarcinoma cell line.
Key words: Fluoroquinolone; Ofloxacin; P-glycoprotein; Multidrug resistance; Topoisomerase II; Multidrug resistance-associated protein
Address correspondence to Sophie Marchal, Laboratoire de Recherche en Oncologie, Centre Alexis Vautrin, Avenue de Bourgogne, F-54511 Vandoeuvre les Nancy cedex, France. Tel: 33 383448306; Fax: 33 383446071; E-mail: s.marchal@nancy.fnclcc.fr
Combination Studies of Antifolates With 5-Fluorouracil in Colon Cancer Cell Lines
Clasina L. van der Wilt, Catherina M. Kuiper, and Godefridus J. Peters
Department of Medical Oncology, University Hospital Vrije Universiteit, Amsterdam, The Netherlands
The combined cytotoxic effects of the thymidylate synthase (TS) inhibitors 5-fluorouracil (5FU) and different antifolates were studied in seven colon cancer cell lines. Growth inhibition of the antifolates, Nolatrexed, Raltitrexed, GW1843U89, or MTA in combination with 5FU, was determined and multiple drug effect analysis showed that the drugs acted mostly additively. The only synergistic interaction was found for 5FU and Nolatrexed in the LS174T cell line. Also Raltitrexed and 5FU were slightly synergistic in WiDr/F cells grown at low folate levels, but for the other cell lines grown at high folate levels this combination was more antagonistic. GW1843U89 and 5FU were mainly additive, while 5FU and MTA showed antagonism in WiDr and additivity in LS174T. The effect of the drugs at their target was evaluated by in situ TS inhibition. We observed lower TS activity in all cells when two drugs were used instead of one. Statistical analysis revealed that none of the values of the combinations was higher or lower than could be expected from the product of the effect of single drugs. We concluded that the effects on TS inhibition were additive for all 5FU/antifolate combinations in all cell lines. DNA strand break formation, as a result of TS inhibition, was measured by means of a fluorometric analysis of DNA unwinding. Raltitrexed-induced DNA damage was significantly increased by 5FU in WiDr cells [single agent: 67% double stranded (ds) DNA, combination: 39% ds DNA, P < 0.0001]. In LS174T a trend for antagonistic effects was observed for combinations of MTA, GW1843U89, or Raltitrexed and 5FU. The combinations showed additive effects in WiDr/F cells. The overall conclusion of the three assays in each of the cell lines indicated that 5FU and antifolate combinations were predominantly additive in colon cancer cells.
Key words: Thymidylate synthase; MTA; Raltitrexed; Nolatrexed; GW1843U89
Address correspondence to Godefridus J. Peters, Department of Medical Oncology, University Hospital Vrije Universiteit, P.O. Box 7057, 1007 MB Amsterdam, The Netherlands. Tel: +31-20-4442633; Fax: +31-20-4443844; E-mail: gj.peters@azvu.nl
The Role of Mismatch Repair in DNA Damage-Induced Apoptosis
Guo-Min Li
Department of Pathology and Laboratory Medicine, Markey Cancer Center, University of Kentucky Medical Center, Lexington, KY 40536
DNA mismatch repair plays a critical role in maintaining genomic integrity. Defects in human mismatch repair are the primary cause of certain types of cancer, including hereditary nonpolyposis colorectal cancer. In the past, the ability of mismatch repair proteins to correct DNA mismatches that occur during DNA replication, repair, and recombination was considered the primary mechanism by which it contributes to genomic stability. However, increasing evidence supports the idea that the mismatch repair system also contributes to genome stability by stimulating DNA damage-induced apoptosis as part of the cytotoxic response to physical and chemical agents. MutS/MutL homologues mediate the process of apoptosis by binding to DNA adducts and either provoking futile repair events or blocking steps in DNA metabolism (i.e., DNA replication and/or repair). This damage recognition step by mismatch repair (MMR) proteins stimulates a signaling cascade for apoptosis, resulting in activation of protein kinase(s) that phosphorylate p53 and/or the related protein p73. Activated p53 and p73 in turn transmit a signal to the apoptotic machinery to execute cell death. The goal of this commentary is to discuss the molecular mechanism(s) by which mismatch repair proteins stimulate apoptosis.
Key words: Mismatch repair; Genomic instability; Cancer; Apoptosis
Address correspondence to Guo-Min Li, Department of Pathology and Laboratory Medicine, University of Kentucky Medical Center, 800 Rose Street, Lexington, KY 40536. Tel: (606) 257-7053; Fax: (606) 323-2094; E-mail: gmli@pop.uky.edu.
Targeted Antiestrogens for the Prevention of Breast Cancer
David J. Bentrem and V. Craig Jordan
Departments of Surgery, Molecular Pharmacology, and Biological Chemistry, Robert H. Lurie Comprehensive Cancer Center, Northwestern University Medical School, Chicago, IL 60611
This commentary explores the recent experience with and the basis for the use of selective estrogen receptor modulators (SERMs) to prevent breast cancer. Chemoprevention has been a goal for many years. As newer agents are unveiled, they will continue to be tested against tamoxifen, the current standard for the treatment and prevention of breast cancer. Raloxifene holds the promise of treating osteoporosis with the beneficial side effect of breast cancer prevention. The Study of Tamoxifen and Raloxifene (STAR) trial and prior prevention studies will be discussed in an attempt understand the bridge from the laboratory to the clinic.
Key words: Breast cancer; Antiestrogens; Tamoxifen; Raloxifene
Address correspondence to V. Craig Jordan, Ph.D., D.Sc., Robert H. Lurie Comprehensive Cancer Center, Olson Pavilion 8258, 303 E. Chicago Avenue, Chicago, IL 60611. Tel: (312) 908-7301; Fax: (312) 908-1372.
Expression of Ribosomal Protein S5 Cloned Gene During Differentiation and Apoptosis in Murine Erythroleukemia (MEL) Cells*
Ioannis S. Vizirianakis, Ioannis S. Pappas, Dimitrios Gougoumas, and Asterios S. Tsiftsoglou
Laboratory of Pharmacology, Department of Pharmaceutical Sciences, Aristotle University of Thessaloniki, 540 06 Thessaloniki, Greece
Murine erythroleukemia (MEL) cells have been used as a suitable model system for studying cellular and molecular mechanisms of erythroid differentiation. In an effort to isolate and characterize genes whose expression change during differentiation, we cloned and sequenced a cDNA of 715 bp (rpS5) from a MEL cDNA library. The cloned mouse cDNA showed significant degree of structural homology in both DNA and protein level to known human and rat genes that encode the S5 proteins of 40S ribosomal subunit. The use of 715-bp cDNA as probe revealed the presence of an RNA transcript in the cytoplasm of MEL and human neuroectodermal RD/TE-671 cells. The steady-state accumulation level of this RNA transcript decreased upon induction of differentiation of both cell lines by treatment with DMSO and UDP-4, two structurally different inducers. Blockade of MEL cell differentiation by the inhibitor N6-methyladenosine preserved the constitutive expression of the rpS5 gene. DNA methylation analysis at CCGG sites located at the rpS5 gene locus in undifferentiated and differentiated MEL cells revealed that the suppression of the rpS5 gene during MEL cell differentiation is not related to any change in methylation at these sites. Moreover, the rpS5 gene continued to be expressed in cells undergoing serum-deprived apoptosis, like in control untreated cells. Therefore, we conclude that there maybe a disparate pattern of expression of the rpS5 gene in differentiating and apoptotic cells. These data can be valuable in understanding the role of ribosomal proteins during differentiation and cell death (apoptosis) of neoplastic cells, although there is no experimental evidence that the suppression of the rpS5 gene is related mechanistically to the induction of differentiation. It may well be considered as part of the differentiation process.
Key words: MEL cells; Differentiation; Apoptosis; cDNA cloning; S5 ribosomal protein; Expression; RD/TE-671 cells
Address correspondence to Asterios S. Tsiftsoglou, Laboratory of Pharmacology, Department of Pharmaceutical Sciences, Aristotle University of Thessaloniki, 540 06 Thessaloniki, Greece. Tel: +3031-997631; Fax: +3031-997618; E-mail: tsif@pharm.auth.gr
*The nucleotide sequence reported in this article has been submitted to the Gen/EMBL Data Bank with accession number Y12431.
Human N-ras, TRK-T1, and RET/PTC3 Oncogenes, Driven by a Thyroglobulin Promoter, Differently Affect the Expression of Differentiation Markers and the Proliferation of Thyroid Epithelial Cells
Giuseppe Portella,1 Donatella Vitagliano,1 Cristina Borselli,1 Rosa Marina Melillo,1 Domenico Salvatore,1 Jay L. Rothstein,2 Giancarlo Vecchio,1 Alfredo Fusco,3 and Massimo Santoro1
1Centro di Endocrinologia ed Oncologia Sperimentale del Consiglio
Nazionale delle Ricerche c/o Dipartimento di Biologia e Patologia Cellulare
e Molecolare, Facoltà di Medicina e Chirurgia, Università
"Federico II," 80131 Naples, Italy
2Department of Otolaryngology-HNS Thomas Jefferson University
Kimmel Cancer Institute, Jefferson Medical College, Philadelphia, PA 19107
3Dipartimento di Medicina Sperimentale e Clinica, Facoltà
di Medicina e Chirurgia, Università "Magna Graecia," 88100 Catanzaro,
Italy
The ras family members and the tyrosine kinases RET and TRK are frequently activated in human tumors of the thyroid gland. To ascertain the effects of these oncogenes in cultured thyroid cells we have generated expression vectors containing activated versions of the three genes under the control of the thyroid-specific thyroglobulin gene promoter. Here we show that the expression of the three oncogenes differently affects thyroid differentiation. While the TRK-T1 oncogene interferes with the capability of thyroid cells of trapping iodide and only marginally affects thyroglobulin gene expression, both RET/PTC3 and N-ras(Gln61-Lys) induce a dramatic reduction of thyroglobulin mRNA and alleviate TSH dependency for cellular growth. However, none of the three oncogenes is able to induce the appearance of neoplastic transformation markers, such as growth in semisolid medium and tumorigenicity in athymic mice. This indicates that genetic events additional to TRK, RET, or N-ras activation are required for fully malignant transformation of thyroid cells.
Key words: Thyroid; Differentiation; ras; TRK; RET; Tumorigenesis
Address correspondence to Giuseppe Portella, Dipartimento di Biologia e Patologia Cellulare e Molecolare, Facoltà di Medicina e Chirurgia di Napoli, Università "Federico II," via S. Pansini 5, 80131 Napoli, Italy. Tel: 39 081 7463056; Fax: 39 081 7463037; E-mail: portella@unina.it
Attenuation of the Induced Differentiation of HL-60 Leukemia Cells by Mitochondrial Chaperone HSP70
Jian Xu,* Helen Hong Xiao,** and Alan C. Sartorelli
Department of Pharmacology and Developmental Therapeutics Program, Cancer Center, Yale University School of Medicine, New Haven, CT 06520
The HSP70 family of heat shock proteins, which are involved in development and cellular differentiation, is elevated in various tumor cell lines. To examine the role of these proteins in neoplastic cell differentiation, four members of the HSP70 multiple gene family (i.e., HSP70, HSC70, GRP78, and mtHSP70) were examined during the induced differentiation of HL-60 promyelocytic leukemia cells. Western analyses showed that continuous exposure for 48 h of HL-60 cells to the differentiation-inducing agents, all-trans retinoic acid, 1,25-dihydroxyvitamin D3, or N-methylformamide, resulted in decreases in mitochondrial HSP70 (mtHSP70), with little change in the levels of HSP70, HSC70, and GRP78. To gain information on the role of mtHSP70 in the differentiation process, HL-60 cells were transfected with either murine mthsp70 cDNA or vector alone. Slightly greater than twofold increases in mtHSP70 protein levels occurred in cells transfected with the mthsp70 cDNA. In vector-transfected HL-60 cells, myeloid differentiation, measured as an increase in CD31 expression and nitroblue tetrazolium positivity, was observed following 3-6 days of treatment with each of the three inducing agents. In contrast, cell differentiation induced by each agent was markedly attenuated in mthsp70-transfected HL-60 cells. These findings suggest that a decrease in mtHSP70 is important for the induced differentiation of HL-60 cells.
Key words: HL-60 leukemia; HSP70 multiple gene family; Mitochondrial chaperone HSP70; Differentiation
Address correspondence to Alan C. Sartorelli, Department of Pharmacology and Developmental Therapeutics Program, Cancer Center, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520. Tel: +1 (203) 785-4533; Fax: +1 (203) 737-2045; E-mail: alan.sartorelli@yale.edu
*Present address: Department of Pharmacology, Merck Research Laboratories, Merck & Co., Inc., West Point, PA 19486.
**Present address: Department of Radiation Oncology, Albert Einstein College of Medicine, Montefiore Medical Center, Bronx, NY 10467.
Marked Variation of Thymidylate Synthase and Folylpolyglutamate Synthetase Gene Expression in Human Colorectal Tumors
Enrico Mini,1 Cristina Biondi,1 Maria Morganti,1 Cristina Napoli,1 Paolo Mazzoni,2 Fabio Cianchi,3 Francesco Tonelli,2 Camillo Cortesini,3 Sergio Capaccioli,4 Ferdinando Ficari,2 Alessandro Quattrone,4 Susanna Rossi,1 and Teresita Mazzei1
1Unità di Chemioterapia, Dipartimento di Farmacologia Preclinica e Clinica, 2Sezione di Chirurgia, Dipartimento di Fisiopatologia Clinica, 3Istituto di Clinica Chirurgica Generale e Discipline Chirurgiche, 4Istituto di Patologia Generale, Università degli Studi di Firenze, Italy
Patients with advanced colorectal cancer are currently being treated with 5-fluorouracil (5-FU)-based chemotherapy. A growing number of patients with resectable disease receive adjuvant therapy with 5-FU/levamisole (LEV) or 5-FU/folinic acid (LV). However, many patients still fail on these treatments, due to occurrence of natural or acquired tumor resistance. Among clinically relevant mechanisms of resistance to fluoropyrimidines, increased expression of thymidylate synthase (TS) has been emphasized. Another potentially relevant mechanism involves a decrease in folylpolyglutamate synthetase (FPGS) expression. To establish the value of these genes as prognostic factors and predictors of the outcome of 5-FU-based chemotherapy in colorectal cancer, we measured their expression in colorectal tumors from patients undergoing surgery and postoperative chemotherapy and compared it with that in normal colonic mucosa. This was done by a semiquantitative, nonradioisotopic polymerase chain reaction (PCR) method using b-actin as an internal standard and expressed as a TS/b-actin or a FPGS/b-actin mRNA ratio. In tumor samples from 21 colorectal cancer patients, TS gene expression varied 118-fold. The median TS/b-actin ratio was, in fact, 41.36 x 10-3 (range 2.49 x 10-3 to 294.54 x 10-3). Little variation in TS gene expression was observed in corresponding normal colonic mucosa; the TS/b-actin gene ratio was lower (median 26.16 x 10-3; range 8.49 x 10-3 to 69.49 x 10-3). Among tumor explants from 20 patients, FPGS expression varied over 161-fold. A similar marked variation was also observed in normal colonic mucosal samples (over 185-fold). Overall and disease-free survival data suggest an inverse association between the level of tumor TS and FPGS expression and clinical prognosis. The availability of this sensitive and accurate assay for gene expression should now make it possible to extend these laboratory/clinical correlations to larger populations.
Key words: Thymidylate synthase; Folylpolyglutamate synthetase; 5-Fluorouracil; Resistance; Colorectal carcinoma
Address correspondence to Teresita Mazzei, Unità di Chemioterapia, Dipartimento di Farmacologia Preclinica e Clinica, Università degli Studi di Firenze, Viale Pieraccini 6, 50139 Firenze, Italy. Tel. +39(0)55-416680; Fax +39(0)55-4271280.
Photokilling Mechanisms Induced by Zinc(II)-Phthalocyanine on Cultured Tumor Cells
Angeles Villanueva,1 Verónica Domínguez,1 Silvia Polo,1 Víctor D. Vendrell,1 Cristina Sanz,2 Magdalena Cañete,1 Angeles Juarranz,1 and Juan C. Stockert1
1Departamento de Biología, Facultad de Ciencias, Universidad
Autónoma de Madrid, Canto Blanco, E-28049 Madrid, Spain
2Centro de Investigaciones Biológicas, Consejo Superior
de Investigaciones Científicas, E-28006 Madrid, Spain
The photosensitizing effects of liposomal zinc(II)-phthalocyanine (ZnPc) on HeLa cells, with emphasis on morphological changes and mechanisms for cell death, have been studied. No dark toxicity for ZnPc alone was found. Incubation for 1 h with ZnPc followed by red light irradiation induced a variable decrease in the surviving of cells, which was related to both drug concentration and irradiation time. A lethal photodynamic effect (100% of the cells are killed: LD100) was induced by 5 x 10-6 M ZnPc and 5-min irradiation, whereas a sublethal effect (60% of the cells are killed: LD60) was detected with 1-7 M ZnPc and 3 min of red light. Toluidine blue and Hoechst 33258 staining showed characteristic alterations of cell morphology. Numerous bubbles on the plasma membrane were found immediately after an LD100 treatment, and a necrotic morphology appeared 24 h later. On the contrary, severe cell shrinkage with nuclear fragmentation, characteristic of apoptosis, was observed 8 and 24 h after LD60 treatments. In this case, propidium iodide-acridine orange labeling and the TUNEL assay confirmed the occurrence of apoptosis. The highest amount of apoptotic cells appeared 24 h after LD60treatments, particularly in detached cells, as revealed by cell counting and DNA electrophoresis. Both apoptotic and necrotic mechanisms for cell death occur in HeLa cells in dependence on the experimental protocol of ZnPc photodynamic treatments.
Key words: Photosensitizers; Zinc(II)-phthalocyanine; HeLa cells, Apoptosis; Necrosis; Photodynamic therapy
Address correspondence to Angeles Villanueva, Departamento de Biología, Facultad de Ciencias, Universidad Aut\a\onoma de Madrid, Canto Blanco, E-28049 Madrid, Spain. Fax: (+34) 91 397 8344; E-mail: angeles.villanueva@uam.es
Cell Death in Paclitaxel-Dependent Chinese Hamster Ovary Cells Is Initiated by the Loss of Telomeric DNA Repeats
Asha S. Multani,1 Joya Chandra,1 David J. McConkey,1 Subrata Sen,2 Fernando Cabral,3 and Sen Pathak1,2
Departments of 1Cancer Biology and 2Laboratory Medicine, The University of Texas M. D. Anderson Cancer Center, and 3Department of Integrative Biology and Pharmacology, The University of Texas Medical School, Houston, TX 77030
We have reported earlier that cell death in a metastatic murine melanoma cell line induced by paclitaxel and its water-soluble conjugates is mediated through the extensive erosion of telomeric repeats. The purpose of this study was to investigate if loss of telomeric repeats was also involved in cell death of Tax-18 and Tax-2-4, two paclitaxel-requiring mutant Chinese hamster ovary (CHO) cell lines. Tax-18 and Tax-2-4 cells were grown in paclitaxel-free culture medium for 24, 48, 72, and 96 h at 37°C and then harvested for cytological preparations. Control cultures of both cell lines were grown in paclitaxel-supplemented medium and harvested simultaneously. We found that: 1) the frequency of telomeric associations in metaphase preparations was increased with the duration of paclitaxel-depleted culture; 2) Tax-18 cells showed a higher incidence (33.0%) of endoreduplicated metaphases at 24 h of paclitaxel-depleted culture than did Tax-2-4 cells, in which endoreduplicated metaphases were rare; 3) the frequency of polyploid cells was increased after 48, 72, and 96 h of paclitaxel-depleted culture for Tax-18 relative to that for Tax-2-4 cells; 4) both cell lines showed reductions in telomeric signals at chromosomal termini, but not in the interphase nuclei; and 5) both cell lines had shorter terminal telomeric restriction fragments after culture in paclitaxel-depleted medium. These results support our earlier observations and indicate that reduction of telomeric repeats is involved in G2/M cell arrest (endoreduplication) followed by severe DNA fragmentation, and then cell death of two CHO mutant cell lines that require paclitaxel for cell division.
Key words: CHO mutant cell lines; Tax-18; Tax-2-4; Telomere erosion; Cell death; Paclitaxel
Address correspondence to Professor Sen Pathak, Cellular Genetics Laboratory, Box 181, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Tel (713) 792-2582; Fax: (713) 792-8747; E-mail: spathak@notes.mdacc.tmc.edu
Involvement of TNF-a in Enhancement of Invasion and Metastasis of Colon 26-L5 Carcinoma Cells in Mice by Social Isolation Stress
Wenjuan Wu, Takeshi Yamaura, Koji Murakami, Masaru Ogasawara, Kazuko Hayashi, Jun Murata, and Ikuo Saiki
Department of Pathogenic Biochemistry, Institute of Natural Medicine, Toyama Medical and Pharmaceutical University, Toyama, Japan
Psychosocial stress has been implicated in tumor metastasis. We have previously reported that social isolation stress exacerbated liver metastasis of colon 26-L5 by partially suppressing the cellular immunity in male Balb/c mice. To further understand the mechanism underlying the influence of isolation stress on liver metastasis, we investigated the effect of social isolation stress on tumor invasion, which is considered to be a pivotal step of tumor metastasis. The invasion and migration of tumor cells obtained from tumor nodules in the isolated mice were more markedly enhanced than that in the group-housed mice. The mRNA expression of proteolytic proteases, including matrix metalloproteinase (MMP)-2, MMP-9, membrane type 1 (MT1)-MMP, and urokinase-type plasminogen activator (u-PA), were increased in the tumor and liver tissues of the isolated mice compared with the control mice. On the other hand, production of plasma TNF-a and expression of hepatic TNF-a mRNA were elevated in the isolated mice with or without tumor burden. Increased TNF-a level was particularly discernible in the liver of tumor-bearing mice. Elevated positive staining for TNF-a was immunohistochemically observed within and around tumor mass in the liver from isolated tumor-bearing mice, compared with group-housed mice. In addition, the invasiveness of tumor cells and the expression of proteolytic enzymes, including MMP-9 and u-PA in tumor cells, were enhanced by the treatment of TNF-a in vitro. Thus, the data suggested that isolation stress-augmented TNF-amay be involved in the enhancement of tumor invasion and metastasis in part by upregulating the proteolytic enzymes such as MMPs and u-PA in tumor and liver tissues.
Key words: Social isolation; Psychological stress; Colon cancer; Metastasis; Invasion; Tumor necrosis factor-a (TNF-a); Matrix metalloproteinase (MMP); Urokinase-type plasminogen activator (u-PA)
Address correspondence to Professor Ikuo Saiki, Institute of Natural Medicine, Toyama Medical and Pharmaceutical University, 2630 Sugitani, Toyama 930-0194, Japan. Tel: +81-76-434-7620; Fax:+81-76-434-5058; E-mail: byosei@ms.toyama-mpu.ac.jp
Cytotoxic Effects Toward Human Hematopoietic Progenitor Cells and Tumor Cell Lines of Paclitaxel, Docetaxel, and Newly Developed Analogues IDN5109, IDN5111, and IDN5127
Cristiano Ferlini,1 Mariagrazia Distefano,1 Luca Pierelli,1 Giuseppina Bonanno,1 Antonella Riva,2 Ezio Bombardelli,2 Iwao Ojima,3 Salvatore Mancuso,1 and Giovanni Scambia1
1Laboratory of Antineoplastic Pharmacology, Department of
Obstetrics and Gynaecology, Universit\g\a Cattolica del Sacro Cuore, Rome,
Italy
2Indena, Spa, Milan, Italy
3Department of Chemistry, State University of New York at
Stony Brook, Stony Brook, NY
The growth inhibitory effect of paclitaxel, docetaxel, and newly developed taxanes IDN5109, IDN5111, and IDN5127 was assessed on peripheral blood (PB) CD34+ maintained in liquid culture and on three human cancer cell lines (MDA-MB231, MCF-7 ADRr, CEM VBLr). Concomitantly, DNA analysis was also performed. For unfractionated peripheral blood progenitor cells (PBPC) toxicity was also assessed by clonogenic assay. The cytotoxic effects induced by taxanes toward PBPC as measured by clonogenic assay were correlated with those found for multidrug resistance (MDR)-positive cell lines (IDN5109 > IDN5111 > IDN5127 > docetaxel > paclitaxel). We established a therapeutic index (TI) between the antitumor activity in MDR-positive cells and the toxicity toward PBPC. Paclitaxel and IDN5109, as determined by TI, showed the best value in MDR-negative and MDR-positive cells, respectively. The ranking of the cytotoxic effects observed in PB CD34+ was not correlated with that obtained in clonogenic assay and in cancer cells (IDN5127 > IDN5109 > docetaxel > IDN5111). Remarkably, in DNA analysis docetaxel induced the maximal cell cycle blocking activity. Newly developed taxanes IDN5109 and IDN5111 are endowed of a profile of anticancer activity in MDR-bearing cells and toxicity toward hematopoietic progenitors better than that of docetaxel. However, mechanism(s) underlying toxicity toward hematopoietic progenitors could be, at least in part, different from that of docetaxel and likely dependent on the interaction with P-glycoprotein function in PB CD34+ cells.
Key words: Cell cycle block; Hematopoietic progenitors; Docetaxel; Paclitaxel; Taxanes
Address correspondence to Prof. Giovanni Scambia, Department of Obstetrics and Gynaecology, Università Cattolica del Sacro Cuore, Largo A. Gemelli, 8, 00168 Rome, Italy. Tel: 39 6 35508736; Fax: 39 6 35508736; E-mail: giovanni.scambia@agora.it
Antimetastatic and Anti-invasive Ability of Phospho-ascorbyl Palmitate Through Intracellular Ascorbate Enrichment and the Resultant Antioxidant Action
Jian-Wen Liu,1 Norio Nagao,1 Katsuhiro Kageyama,2 and Nobuhiko Miwa1
1Department of Cell Biochemistry, Hiroshima Prefectural University
School of BioSciences, Shobara, Hiroshima 727-0023, Japan
2Radioisotope Centre, Osaka City University Medical School,
Abeno, Osaka 545-0051, Japan
A lipophilic and auto-oxidation-resistant derivative of ascorbic acid (Asc), Asc-2-O-phosphate-6-O-palmitate (Asc2P6Plm), was shown to exert an invasion-inhibitory action as promptly as 30-40 min for 50% inhibition and 60-90 min for 80% inhibition after entering fibrosarcoma HT-1080 cells. Invasive inhibition of 95-97% was accomplished by Asc2P6Plm of doses exhibiting no cytotoxicity under the same conditions. Asc2P6Plm was dephosphorylated and esterolyzed to Asc, which enriched the intracellular Asc dose dependently in invasion-suppressed cells, contrasting with no detectable Asc in invasive cells fed without Asc2P6Plm. Intracellular dehydroAsc (DehAsc), unexpectedly, amounted to 1.02-1.65-fold as much as intracellular Asc, suggesting that invasive cells underwent oxidative stress, the repression of which resulted in both inhibition of tumor invasion and oxidative conversion of Asc to DehAsc. Correspondingly, intracellular oxidants fluorometrically detected with a redox indicator CDCFH were more abundant in invasive cells than in invasion-suppressed cells fed with Asc2P6Plm. Invasion inhibitory effects of Asc2P6Plm necessitated the extensive inhibition of the major gelatinases MMP-9 and MMP-2, as shown by zymography and Western blots, but did not necessitate direct expression of the metastasis suppressor gene nm23, taking as long as 6-18 h in contrast to a prompt action of Asc2P6Plm. Antimetastatic effects on melanoma B16BL6 cells were given dose dependently by intravenous administration or pretreatment with Asc2P6Plm. Thus, Asc2P6Plm is anticipated as an antimetastatic agent via the potent antioxidant activity.
Key words: Ascorbic acid; Invasion; Metastasis; Cytotoxicity; Reactive oxygen species; Matrix metalloprotease
Address correspondence to Nobuhiko Miwa, Ph.D., Department of Cell Biochemistry, Hiroshima Prefectural University School of BioSciences, Shobara, Hiroshima 727-0023, Japan. Tel: +81-8247-4-1754; Fax: +81-8247-4-0191;E-mail: miwa-nob@bio.hiroshima-pu.ac.jp
Characterization of a Novel Immunocytolytic Factor Secreted by Pancreatic Adenocarcinoma
Celia M. Divino,1 Luz P. Angel,1 Steven T. Brower,1 and Shu-Hsia Chen2
1Division of Surgical Oncology, Department of Surgery, and 2Institute for Gene Therapy and Molecular Medicine, Mount Sinai School of Medicine, The Mount Sinai Medical Center, New York, NY 10029-6574
We observed a putative immunocytolytic factor secreted in the supernatant of several pancreatic adenocarcinoma cell lines that induces apoptosis in lymphocytes. A marked reduction in the viability of the target splenocytes was evident after co-incubation with the supernatants from various pancreatic adenocarcinoma cell lines (human, hamster, and murine). The immunocytolytic effect was not evident with the conditioned media of normal pancreatic duct epithelial cells or other nonpancreatic tumor cells. Biologic activity of the supernatants was determined to be heat sensitive and reside in a 30- to 50-kDa range. Immune and functional assays have excluded known immunosuppressive factors.
Key words: Pancreatic cancer; Immunocytolytic factor; Apoptosis; Lymphocytes
Address correspondence to Shu-Hsia Chen, Institute for Gene Therapy and Molecular Medicine, Mount Sinai School of Medicine, The Mount Sinai Medical Center, One Gustave L. Levy Place, Box 1496, New York, NY 10029-6574. Tel: (212) 824-7753; Fax: (212) 803-6740; E-mail: chens01@doc.mssm.edu.
Inhibition of Metastatic Carcinoma Cell Growth in Livers by Poly(I):Poly(C)/Cationic Liposome Complex (LIC)
Kazuko Hirabayashi,1 Junichi Yano,1 Hisashi Takesue,1 Noriko Fujiwara,2 and Tatsuro Irimura2
1Discovery Research Laboratories, Nippon Shinyaku Co. Ltd.,
Kyoto 601-8550, Japan
2Graduate School of Pharmaceutical Sciences, The University
of Tokyo, Tokyo 113-0033, Japan
The complex of poly(I):poly(C) and a new cationic liposome (LIC) has a potent antitumor activity against many tumor cell lines in vitro, whereas poly(I):poly(C) itself has no such activity. In the present study we tested the sensitivity of 21 human colon and pancreatic cancer cell lines to LIC or Adriamycin in vitro. The growth of most of the cell lines was strongly inhibited by both LIC and Adriamycin in vitro, although a few insensitive cell lines were different. We also studied the in vivo antitumor activity of LIC or Adriamycin in three experimental liver metastasis models in nude mice using a human pancreatic cancer cell line (AsPC-1) and two human colon cancer cell lines (Ls174T and HCC-M1544). The administration of LIC or Adriamycin was started 3 days after the injection of tumor cells. Animals received 0.1 mg/kg LIC IV twice weekly or 5 mg/kg Adriamycin IV every 5 days during the experiments. LIC showed potent antitumor activity in all three liver cancer models. Although Adriamycin had potent antitumor activity in the HCC-M1544 model, it had only a moderate effect in the AsPC-1 model and at most a weak effect in the Ls174T model. At the effective doses LIC did not cause detectable pathological changes in the liver and did not elicit toxicity to mice in these models, whereas Adriamycin did exhibit toxic effects. These results suggest that LIC is a promising candidate drug to treat hepatic metastasis.
Key words: Poly(I):poly(C); Cationic liposome; Metastatic liver cancer; Apoptosis
Address correspondence to Kazuko Hirabayashi, Discovery Research Laboratories, Nippon Shinyaku Co. Ltd., 14 Nishinosho-Monguchi-cho, Kisshoin, Minami-ku, Kyoto 601-8550, Japan. Tel: +81-75-321-9169; Fax: +81-75-314-3269; E-mail: k.hirabayashi@po.nippon-shinyaku.co.jp.
Growth Inhibition and Antimetastatic Effect of Antisense Poly-DNP-RNA on Human Breast Cancer Cells
Kun Ru,1 Shawn Schmitt,1 William I. James,2 and Jui H. Wang1
1Bioenergetics Laboratory, Natural Sciences Complex, State
University of New York, Buffalo, NY 14260-3000
2Department of Pathology, Kenmore Mercy Hospital, Buffalo,
NY 14217
The RNase-resistant and membrane-permeable antisense poly-2´-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIa subunit of protein kinase A (RIa/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIa poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.
Key words: Antisense; Breast cancer; Poly-DNP-RNA; SCID mice
Address correspondence to Jui H. Wang, Bioenergetics Laboratory, Natural Sciences Complex, State University of New York, Buffalo, NY 14260-3000. Tel: (716) 645-6800, ext. 2236; Fax: (716) 645-6949; E-mail: kunru@acsu.buffalo.edu.
Significant Increase of Adenovirus Infectivity in Glioma Cell Lines by Extracellular Domain of hCAR
Toshiki Mori,1,3 Hirofumi Arakawa,1 Takashi Tokino,2 Katsuyoshi Mineura,3 and Yusuke Nakamura1
1Laboratory of Molecular Medicine, Human Genome Center, Institute
of Medical Science, University of Tokyo, Shirokanedai 4-6-1, Minato-ku,
Tokyo 108-8639, Japan
2Department of Molecular Biology, Cancer Research Institute,
Sapporo Medical University School of Medicine, Sapporo, Japan
3Department of Neurosurgery, Kyoto Prefectural University
of Medicine, Kyoto, Japan
Recombinant adenoviruses are highly advantageous as vectors for transferring genes into mammalian cells, but the transfer is not efficient in all types of cells. We investigated the effects of four adenoviral receptors [integrinav, integrinb3, integrinb5, and human coxsackievirus and adenovirus receptor (hCAR)] on adenovirus-mediated transfer of exogenous cDNA into each of 10 glioma cell lines. Transfection efficiency varied widely from one cell line to another (0-100%) when we measured it by infection with AdLacZ, a vector designed to express b-galactosidase. Levels of integrinav and integrinb5 expression were similar among the 10 cell lines, but expression of hCAR and integrinb3 varied significantly. As these observations indicated a possible correlation between expression of hCAR and the efficiency of gene transfer, we induced the hCAR gene into three glioma cell lines (T98G, U118MG, and U138MG) that expressed hCAR at very low levels and had also revealed low efficiencies of adenoviral gene transfer. In U118MG- and U138MG-derived cells that had regained the ability to express hCAR in stable fashion, adenovirus-mediated gene transfer became highly efficient. Moreover, addition of the peptide corresponding to the extracellular domain of hCAR (ECD-hCAR) by preincubation significantly increased the adenovirus infectivity to these adenovirus-tolerant cells. These results suggest that hCAR could be one of important determinants of the infectivity of adenovirus, and that the ECD-hCAR might be a novel useful tool for improvement of adenovirus-mediated gene therapy against the adenovirus-tolerant cancer cells.
Key words: hCAR; Extracellular domain; Adenovirus vector; Infectivity; Glioma cells
Address correspondence to Yusuke Nakamura, M.D., Ph.D., Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 1088639, Japan. Fax: 81-3-5449-5433; Tel: 81-3-5449-5372; E-mail: yusuke@ims.u-tokyo.ac.jp
P450-Expression in Brain Tumors
Heike Knüpfer,1,2 Matthias M. Knüpfer,3 Marc Hotfilder,4 and Rainer Preib1
1University of Leipzig, Department of Clinical Pharmacology,
Leipzig, Germany
2Paul Flechsig Institute of Brain Research, Department of
Neuroanatomy, Leipzig, Germany
3University Hospital, Department of Pediatric Hematology
and Oncology, Leipzig, Germany
4University of Münster, Children's Hospital, Experimental
Neurooncology, Münster, Germany
Oxazaphosphorines are inactive anticancer prodrugs that are bioactivated by hepatic cytochrome P450. Besides hepatic metabolism, there is increasing interest in the possibility of intratumoral activation of oxazaphosphorines by P450. Therefore, we investigated the expression of P450 (CYP3A4, CYP3A5, CYP2C9) by RT-PCR in 10 different brain tumor samples. Because P450 may be downregulated by interleukin-1 (IL-1) and IL-6, the receptors for IL-1 and IL-6 were analyzed. None of the brain tumors was positive for CYP3A4 whereas CYP3A5 was detected in 3 out of 10 tumors (two meningeomas, one medulloblastoma grade IV). All five gliomas, an ependymoma, and a lymphoma-metastase gave no signal. CYP2C9 mRNA was present in every sample studied. All samples were positive for IL-1 and IL-6 receptors. In summary, we have demonstrated that tumors of the CNS express P450, indicating that activation of prodrugs like oxazaphosphorines may take place intratumorally. However, the most abundantly hepatically expressed CYP3A4 enzyme is absent in the brain tumor samples. The presence of the IL-1 and IL-6 receptors opens the possibility that the well-known downregulating influence of these cytokines also takes place in brain tumors.
Key words: PCR; CYP; Cancer; Oxazaphosphorines; Interleukins
Address correspondence to Dr. rer. nat. Heike Knüpfer, Paul Flechsig Institute of Brain Research, Department of Neuroanatomy, University of Leipzig, Jahnalle 59, D-04109 Leipzig, Germany. Tel. +49-341-9725757; Fax. +49-341-2114397; E-mail: popph@server3.medizin.uni-leipzig.de
A Clinical-Pharmacological Evaluation of Percutaneous Isolated Hepatic Infusion of Doxorubicin in Patients With Unresectable Liver Tumors
Wen-Jen Hwu,1 Ronald R. Salem,2 Jeffrey Pollak,3 Melvin Rosenblatt,3 Elizabeth D'Andrea,2 Janine J. Leffert,1 Susan Faraone,1 John C. Marsh,1 and Giuseppe Pizzorno1
1Section of Medical Oncology, Department of Medicine, 2Section of Surgical Oncology, Department of Surgery, and 3Department of Diagnostic Imaging, Yale University School of Medicine, New Haven, CT 06520
A dose escalation study of hepatic arterial infusion of doxorubicin during hemodynamic isolation of the liver (the Delcath system) was conducted to: 1) study the pharmacokinetics of regional doxorubicin therapy, and 2) define therapeutic efficacy in the treatment of unresectable liver tumors. Eighteen patients with unresectable primary or metastatic tumor in the liver were treated with 57 procedures. Pharmacokinetic studies were performed on all treatments. Hepatic extraction ratio of doxorubicin remained constant at 60.3 ± 12.1%, independent of the dose escalation. The calculated intrahepatic concentration of doxorubicin ranged from 30 to 88 mg/ml when the dosage of doxorubicin was escalated from 50 to 120 mg/m2. Dose-limiting systemic toxicity (grade 4 myelosuppression) was observed at 120 mg/m2. Twelve of 14 patients who received more than one treatment at 90 or 120 mg/m2 were evaluable for disease response: there were 4 partial responses, 3 minor responses, 1 stable disease, and 4 progressive disease. The median overall survival of responders was 23 months, and for nonresponders it was 8 months. We have demonstrated a dose-response effect of hepatic infusion of doxorubicin at 90 and 120 mg/m2 in advanced hepatic malignancies. The isolated hepatic perfusion system improves the therapeutic index of doxorubicin and provides pharmacologic justification for its use in the treatment of unresectable hepatic malignancies, especially metastatic melanoma and sarcoma.
Key words: Intra-arterial chemotherapy; Venous isolation; Hemofiltration; Pharmacokinetics
Address correspondence to Dr. Wen-Jen Hwu, Section of Melanoma, Clinical Immunology Service, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. Tel: (212) 639-5096; Fax: (212) 717-3345; E-mail: hwuw@mskcc.org.
Elevated Antibody Levels to Epstein-Barr Virus Antigens in Patients With Hairy Cell Leukemia Compared to Controls in Relation to Exposure to Pesticides, Organic Solvents, Animals, and Exhausts
Marie Nordström,1,4 Lennart Hardell,1 Annika Linde,2,3 Lotti Schloss,3 and Åsa Näsman1
1Department of Oncology, Örebro Medical Centre, S-701
85 Örebro, Sweden
2Department of Laboratory Medicine, Karolinska Hospital,
S-175 76 Stockholm, Sweden
3Department of Virology, Swedish Institute for Infectious
Disease Control, S-171 82 Solna, Sweden
4Division of Oncology, Faculty of Health Sciences, Linköping
University, S-581 83 Linköping, Sweden
Epstein-Barr virus (EBV) is a B-lymphotropic human herpes virus infecting B-cells, which has been associated with lymphoid malignancies, above all non-Hodgkin lymphomas (NHL). Severe immunosuppression is the best recognized risk factor for NHL. Many factors in the environment that have been described as risk factors for NHL cause measurable changes in immune functions. Hairy cell leukemia (HCL) is a rare, indolent non-Hodgkin lymphoma, originating from B-lymphocytes. This was a case-control study including 111 male cases with HCL and 400 controls. In a subgroup of 57 cases and 65 controls analysis of antibodies to EBV early antigen, viral capsid antigen, and EBNA-1, measured as P107, was performed. In this study, we confirm other studies describing elevated levels of antibodies to the EBV early antigen (EA) in patients with HCL compared to controls. We found only minor differences in the levels of antibodies to the viral capsid antigen (VCA) and EBNA-1, measured as P107. We found a positive association of a titer to EA IgG > 40 (OR 4.1; CI 1.9-9.5). The ORs were further elevated when subjects with high levels of EA IgG and exposed to environmental agents such as organic solvents, certain pesticides, impregnating agents, animals, and exhausts were compared to those subjects with low levels and were not exposed. Antibody reactivity against the EBV EBNA 1-alanine-glycine repeat (P107 IgG) above the median gave an increased OR for HCL, which further increased in subjects exposed to organic solvents, certain pesticides, impregnating agents, animals, and exhausts. However, the numbers of exposed cases and controls were small in some of the calculations.
Key words: Epstein-Barr virus (EBV); Early antigen (EA); EBNA-1; Pesticides; Exhausts; Animals
Address correspondence to K. Marie Nordström, M.D., Department of Oncology, Örebro Medical Centre, S-701 85 Örebro, Sweden. Tel: +4619151000; Fax: +46196021000, E-mail: marie.nordstrom@orebroll.se